Biomod/2012/Titech/Nano-Jugglers/Results
From OpenWetWare
| Line 94: | Line 94: | ||
|'''Image7''' | |'''Image7''' | ||
|- | |- | ||
| - | |[[Image:10umbfAuVD.jpg|220px]] | + | |[[Image:10umbfAuVD.jpg|Image5|220px]] |
| - | |[[Image:10umafAuVD.jpg|220px]] | + | |[[Image:10umafAuVD.jpg|Image6|220px]] |
| - | |[[Image:10umafCrVD.jpg|220px]] | + | |[[Image:10umafCrVD.jpg|Image7|220px]] |
|- | |- | ||
|10µm polystyrene beads was spread on the cover glass in a single layer. | |10µm polystyrene beads was spread on the cover glass in a single layer. | ||
Revision as of 06:27, 14 October 2012
|
|
0.Body
- Construction of the body of Biomolecular Rocket
- Rocket is consisted of 10μm beads, platinum or catalase, and DNA. By using DNA, platinum or catalase particles are conjugated to 10μm beads. Beads have been addressed by the deposition of gold and chromium, so DNA was able to conjugate to beads region-specific. In addition, we designed the photoresponsive DNA for allowing detachment of the engines from the Biomolecular rocket’s body upon the UV light irradiation in a region-specific manner.
- In this section, we examined 5 experiments.
Vapor deposition of Au and Cr on the polystyrene body

We succeeded in selective coating of polystyrene beads by vapor deposition of Au and Cr.
In this project, gold and chromium were deposited on the polystyrene beads in order to conjugate specific DNA onto the determined location on the surface.- >>see Method
- From these pictures, we observed that vapor deposition can make hemisphere membrane of gold. By comparing the color of figure1 and figure2, micro-beads completely covered by gold are more black and have a metallic luster. From figure3 , it is possible that the 40μm beads can deposit gold as hemisphere in that the colors of beads sphere’s limbs are different. Figure 4 shows that the 40μm beads was covered by two metals which are gold and chromium.We succeeded in dividing the surface of the beads for three parts such as polystyrene, gold and chromium.
- We experimented not just 40µm polystyrene beads but also 10µm polystyrene beads. The more beads smaller, the more difficult to confirm whether beads is covered metal or not. Image5 show that 10µm polystyrene beads was spread on the cover glass in a single layer. Image6 show 10µm polystyrene beads. After gold deposition, a hemisphere of the beads is covered gold. we put the beads on a ethanol solution and confided whether beads was covered or not. As a result, we confirmed right bead in this image is covered by gold. A left bead in this image is also covered by gold, but a gold surface of the bead was the upper side, so we couldn't observe a boundary between gold surface and polystyrene surface. After chromium deposition, the half surface of the beads was covered by chromium, and the quarter surface of the beads covered by gold. However, it is difficult to observe a range of metal surface.
- From this result, we would able to detach catalytic engine specifically from the body of Biomolecular Rocket. And this makes the body of Biomolecular Rocket and controls their direction.
DNA design

We designed nine DNA strands by using NUPACK in order to hybridize at constant temperature.
- >>see Method
- We selected two DNA strands from a treatise. In the below, there are two DNA strands.
- 5’-GCATCTACACTCAATACCCAGCC-3’
- 5’-CGTCTATTGCTTGTCACTTCCCC-3’
- And then, we adjusted number of bases of the DNA strands. This is because we need to dissociate DNA strands easily as to control Biomolecular Rocket by detaching catalytic engines from the body. As a result, we adjusted one DNA strand to 11 bases from 23 bases.
- seqA' 5’-GCATCTACACTCAATACCCAGCC-3’
- seqA 5’-AATACCCAGCC-3’
- Four azobenzene molecules is incorporated into this DNA strand for photo switching. We also designed complementary DNA strands.
- seqA 5’-AATACCCAGCC-3’
- seqAc 5’-GGCTGGGTATT-3’
- seqB 5’-CGTCTATTGCTTGTCACTTCCCC-3’
- seqBc 5'-GGGGAAGTGACAAGCAATAGACG-3'
- We analyzed melting temperature of DNA hybridization of each DNA strand and complementary DNA strand. Result of analysis is below.
- In addition, we modified amino group to DNA strands for conjugation onto a polystyrene surface. And we also modified thiol group to DNA strands for conjugation onto a gold and platinum surface.
seqA_5thiol [ThiSS]AATXACXCCXAGXCC seqAc_5thiol [ThiSS]GGCTGGGTATT seqB_5thiol [ThiSS]CGTCTATTGCTTGTCACTTCCCC seqBc_5amino [AminoC6]GGGGAAGTGACAAGCAATAGACG
- Moreover, we designed DNA strands that have linker part.
seqAc_5thiol_T15 [ThiSS]TTTTTTTTTTTTTTTGGCTGGGTATT seqB_5thiol_T15 [ThiSS]TTTTTTTTTTTTTTTATTGCTTGTCACTTCCCC seqBc_5amino_T15 [AminoC6]TTTTTTTTTTTTTTTAGTGACAAGCAATAGACG
- Finally, we designed FAM modified DNA strands for confirming to success experiments of EDAC conjugation and thiol conjugation.
seqB_5FAM [6-FAM]CGTCTATTGCTTGTCACTTCCCC seqBc_5FAM [6-FAM]GGGGAAGTGACAAGCAATAGACG
- On the below, there are all DNA strands we designed.
- The DNA strands
seqA_azo4_5thiol [ThiSS]AATXACXCCXAGXCC (X=Azobenzene) seqAc_5thiol [ThiSS]GGCTGGGTATT seqAc_5thiol_T15 [ThiSS]TTTTTTTTTTTTTTTGGCTGGGTATT seqB_5thiol [ThiSS]CGTCTATTGCTTGTCACTTCCCC seqB_5thiol_T15 [ThiSS]TTTTTTTTTTTTTTTATTGCTTGTCACTTCCCC seqB_5FAM [6-FAM]CGTCTATTGCTTGTCACTTCCCC seqBc_5amino [AminoC6]GGGGAAGTGACAAGCAATAGACG seqBc_5amino_T15 [AminoC6]TTTTTTTTTTTTTTTAGTGACAAGCAATAGACG seqBc_5FAM [6-FAM]GGGGAAGTGACAAGCAATAGACG
- (The DNA strands selected by us.)
DNA conjugation
EDAC conjugation

We succeeded in amino modified DNA conjugation to polystyrene surface by EDAC conjugation.
We bond polystyrene-beads with DNA using EDAC. To confirm that amino modified DNA is bind to polystyrene, we hybridize the DNA with FAM and observe them under blue light by microscope.
- >>see Method
- Polystyrene beads which were treated with EDAC conjugation exhibited fluorescence, on the othr hand polystyrene beads which were not treated with EDAC conjugation didn't exhibit fluorescence. this is because EDAC treated beads could hybridize Complementary FAM DNA. The othr beads couldn't hybridize FAM DNA in that there were no surface area that could be conjugated to.
- These pictures shows that we succeeded in amino modified DNA conjugation to polystyrene surface by EDAC conjugation.
SAM conjugation

We succeeded in thiol modified DNA conjugation onto gold surface by SAM.
Self-assembled monolayers (SAM) of molecules are molecular assemblies formed spontaneously on substrate surfaces by chemical adsorption. this reaction enabled us to conjugate DNA onto gold and/or platinum surface.
- >>see Method

Image1 shows the state of thiol-modified DNA and gold-deposited cover glass reaction. Spot 1 and 4 are phosphate and saline buffer. Spot 2 and 5 are phosphate and saline buffer that DNA was dissolved in. Spot 3 and 6 are phosphate and saline buffer that thiol-modified DNA was dissolved. Final concentration of phosphate and saline buffer are the same in these spot. But 1、2 and 3 are added NaCl concentration immediately after 24 hours of incubation. On the other hand 4, 5, and 6 are intended to raise the concentration of NaCl every 2 hours after 24 hours of incubation for 6hours, then incubate more 16hours. In image2, gold-deposited cover glass is washed with 3 × SSC, then it was blotted on the surface of the water.
- We observe that there were few signs after washing in 1,2,4 and 5.On the other hand, 3 and 6 were left water. This is expected that this spot of gold surface is covered with DNA by thiol conjugation, and became partially hydrophilic. Other spots are still hydrophobic in that there are no conjugations of DNA.
- From this result, we were determined that thiol conjugation is completed.
Catalyst conjugation by DNA hybridization

We tried to catalyst conjugation by DNA hybridization.
DNA hybridization enable us to conjugate each materials in that DNA strand transits to take thermodynamically stable forms.
- >>see Method
1.Rail-free
- Energy prodction for rail-free movement
- In order to realize rail-free movement, we looked at the function of catalyst. Platinum or catalase catalysts decompose H2O2 and emit H2O and O2 bubbles. Since the driving force created by divergence of bubbles, and rocket proceeds by dissociation of oxygen, rail does not require.
- In this section, we show 3 results that involved in energy production for rail-free movement.
DNA hybridization in solution of H2O2
We used PAGE electrophoresis to ascertain the stability of DNA duplex in thin H₂O₂ solution 1%~5%.
PAGE electrophoresis shows the difference of molecular weight that comes from denaturetion or hybridization in the form of bands.- >>see Method
- This image shows the observation results of DNA hybridization in solution of Hydrogen peroxide for 90minutes.From the picture, the hybridized DNA band appear in lane 1,2,3&8. In lane 4,5,6&7 appears single strand band. Lane1&8 are the same, lane 2 & 3 are added hydrogen peroxide solution (1% and 5% for 1h)for 90 minutes. In Lane 5&7 shows the observation results of single strand DNA (ssDNA) in solution of Hydrogen peroxide. In lane 4&6 are the control band of ssDNA.
- Upper white dotted line represents the same position of Lane 1&8 in that they are the same sample. Comparing between 4.5.6&7, these 4 lines appear lower than the white line, and 4-5and 6-7 are few differences. If hydrogen peroxide affects ssDNA, destroy, tear up or denature, line 5 and 7 will appear in the lower position or becomes unclear. Judging from appearances, differences between positive and negative control ware few.Comparing 1,2,3 and 8,these lines are completely appear in the white bar.Differences between these lines are only concentration of hydrogen peroxide. So, we conclude that there is no influence of hydrogen peroxide for DNA hybridizations however DNA is exposed to hydrogen peroxide within 90minutes.So, we could determine that there is no effect of hydrogen peroxide for dsDNA as well as ssDNA.
Observation of platinum hemisphere behavior in solution of H2O2

- >>see Method
Energy production by using catalase

- >>see Method
2.High-speed
- High-speed movement of Biomolecular Rocket
- Catalytic engine produced sufficient energy to move quickly, but further accelerate the Biomolecular Rocket, we conjugated numerous platinum catalytic engines to a rocket body by taking advantage of DNA hybridization and denaturation. Emission of the bubbles depends on the surface area of catalyst. If the catalytic surface area is expanded, it is obvious that our rocket will be able to emit more bubbles and speeding up.
- In this section, we show 2 results that involved in high-speed movement of biomolecular Rocket.
Analysis of platinum by High-speed camera

- >>see Method
Simulation for speeding-up of Biomolecular Rocket
3.Control
- Directional control of Biomolecular Rocket
- Direction of the rail-free movement of our rocket can be controlled, since we designed the photoresponsive DNA. Photoresponsive DNA structure is changed by UV light irradiation, then dissociation of double strand DNA will happen.
- In this section, we show 3 results that involved in directional control of biomolecular Rocket.
Design of azobenzene-modified DNA

We designed photo-responsive DNA strand in order to control the direction of Biomolecular Rocket.
- >>see Method
We incorporated 4 azobenzene units into "seqA_thiol" DNA strand so that we can quickly dissociated DNA duplex. seqA_azo4_5thiol [ThiSS]AATXACXCCXAGXCC (X=Azobenzene)
Dissociation of azobenzene-modified DNA by UV-light irradiation

Azobenzene including DNA can easily dissociate its duplex by irradiating UV-light. We put this switching system in the rocket body and enabled its control.
- >>see Method
No. Solusion(time irradiating UV-light(minute)) light wavelength(nm) absorbance 1 A(0) 265 0.224 2 B(0) 261 0.153 3 A+B(0) 263 0.138 an average absorbance of number 1 and 2 (0.188.5) 4 A+B(1) 262 0.179 5 A+B(5) 262 0.179 6 A+B(30) 262 0.178
- A: Azobanzen including ssDNA
- B: Normal ssDNA which is complimentary DNA with A
- A+B: this solution include A and B
- The above table shows the relationship between the time of irradiating UV-light and the absorbance of photoresponsive DNA. The detail is on the page 'Azobenzen Protocol'.
Discussion
- A relational expression about absorbance can be expressed as follows.
-
- (Abs: absorbance, ε: the absorption coefficient, c: strength, d: length of a visual leg )
- Solution A+B include 5µM strength of DNA i and DNA ii, so when no DNA formed duplex in the solution A+B, we can simply calculate its absorbance. The value is 188.5(calculated an average absorbance of No.1 and 2). Compared with this value and the absorbance of No.3, the former is 37% larger than the latter. In brief, We thought this difference comes from that DNA formed duplex in the solution of No.3 and interactions between base pairs decrease the UV absorbance relative to single strands.
- In this point, we believed that the complementary photo-responsive DNAs can form duplex.
- Look at the absorbance of No.3 and No.4~6, as the solution A+B was irradiated longer time, its absorbance suddenly move upwards from a border between No.3 and No.4. We thought this difference comes from that DNA duplex completely dissociated in the solution of No.4~6 due to more than 1 minute irradiation of the UV-light.
- In this point, we believed that the photo-responsive DNA duplex which we designed can be dissociated with irradiation of the UV-light.











