Biomod/2012/Titech/Nano-Jugglers/Results: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
Line 1: Line 1:
{{Titech/Nano-Jugglers/HEAD}}
{{Titech/Nano-Jugglers/HEAD}}
<table width="100%" cellspacing="0">
=Results=
<tr valign="top"><td>
{|style="margin-left:20px" border="1"
<table width="100%" cellspacing="0" frame="rhs">
|colspan="3"|<html><body><A href=#0._Construction_of_Biomolecular_Rocket title="Body"><img src="http://openwetware.org/images/b/b5/BM.jpg" border=0 width=310 height=240></a></body></html>
<tr align="center" width=240px>
|style="padding:10px"|
<html><body>
&nbsp;&nbsp;&nbsp;&nbsp;'''Construction of Biomolecular Rocket'''<br><br>
<td align="center" width="240px"><A href=#0.Body title="Body"><img src="http://openwetware.org/images/5/50/Goals.jpg" border=0 width=240 height=180></a></td>
*We constructed Biomolecular Rocket composed of a micrometer-sized body and many catalytic engines. The catalytic engines were conjugated to the body using DNA-bead linkers in a spatially selective manner.<br><br>
</body></html>
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[[Biomod/2012/Titech/Nano-Jugglers/Results#0._Construction_of_Biomolecular_Rocket|Shown in detail below]]
</tr>
|}
<tr>
{|style="margin-left:20px" border="1"
<td valign="top">
|<html><body><A href=#1._Power_supply_for_the_rail-free_movement_of_the_Biomolecular_Rocket title="Rail-free"><img src="http://openwetware.org/images/7/7f/Rail-free%E3%80%80movement_kinesin.jpg" border=0 width=310 height=220></a></body></html><br>'''Power supply for the rail-free movement of the Biomolecular Rocket'''<br>
<font color="green">'''Construction of the body'''</font><br><br><hr>
|<html><body><A href=#2._Realization_of_the_high-speed_movement_of_the_Biomolecular_Rocket title="High-speed"><img src="http://openwetware.org/images/8/89/High-speed_movement.jpg" border=0 width=310 height=220></a></body></html><br>'''Realization of high-speed movement of the Biomolecular Rocket'''
*We constructed the micrometer-sized body of the Biomolecular Rocket by selective modification of DNA and catalytic engines. <br>
|<html><body><A href=#3._Introduction_of_a_photo-switchable_DNA_system_for_the_directional_control title="Control"><img src="http://openwetware.org/images/d/dd/Control_image.jpg" border=0 width=310 height=220></a></body></html><br>'''Introduction of a photo-switchable DNA system for the directional control'''
[[Biomod/2012/Titech/Nano-Jugglers/Results#0.Body|Shown in detail below]]
|-
</td>
|
</tr>
*We realized the rail-free movement by power generation with catalytic reactions of platinum and catalase.<br><br><br><br><br>
</table>
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[[Biomod/2012/Titech/Nano-Jugglers/Results#1._Power_supply_for_the_rail-free_movement_of_the_Biomolecular_Rocket|Shown in detail below]]  
 
|
</td>
*We realized the high-speed movement by power generation with catalytic reactions of platinum and catalase, and analyzed the speed.
<td valign="top">
*We carried out numerical simulations of the high-speed movement of the Biomolecular Rockets.<br>
 
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[[Biomod/2012/Titech/Nano-Jugglers/Results#2._Realization_of_the_high-speed_movement_of_the_Biomolecular_Rocket|Shown in detail below]]
<table width="100%" cellspacing="0">
|
<tr align="center" width=240px>
*We developed a photo-switchable DNA system for controlling of the Bimolecular Rocket using UV light irradiation.
<html><body>
*We investigated directional control of the Biomolecular Rocket in the simulations.<br>
<td align="center" width="240px"><A href=#1.Rail-free title="Rail-free"><img src="http://openwetware.org/images/7/7f/Rail-free%E3%80%80movement_kinesin.jpg" border=0 width=240 height=180></a></td>
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[[Biomod/2012/Titech/Nano-Jugglers/Results#3._Introduction_of_a_photo-switchable_DNA_system_for_the_directional_control|Shown in detail below]]
<td align="center" width="240px"><A href=#2.High-speed title="High-speed"><img src="http://openwetware.org/images/8/89/High-speed_movement.jpg" border=0 width=240 height=180></a></td>
|}
<td align="center" width="240px"><A href=#3.Control title="Control"><img src="http://openwetware.org/images/d/dd/Control_image.jpg" border=0 width=240 height=180></a></td>
</body></html>
</tr>
<tr valign="top">
<td>
<font color="red">'''Energy production for rail-free movement'''</font><hr>
*We realized rail-free movement by taking advantage of catalytic reaction such as platinum, and catalase.<br>
[[Biomod/2012/Titech/Nano-Jugglers/Results#1.Rail-free|Shown in detail below]] </td>
<td>
<font color="blue">'''High-speed movement of Biomolecular Rocket'''</font><hr>
*we analized the detailed platinum particles movement in solution of H<small>2</small>O and O<small>2</small>.
*We ran high-speed movement in simulation.<br>
[[Biomod/2012/Titech/Nano-Jugglers/Results#2.High-speed|Shown in detail below]]
</td>
<td>
<font color="yellow">'''Directional control of Biomolecular Rocket'''</font><hr>
*We succeeded to dissociate azobenzene-modified DNA when we irradiate UV.
*We realized directional control of Biomolecular Rocket in simulation.<br>
[[Biomod/2012/Titech/Nano-Jugglers/Results#3.Control|Shown in detail below]]
</td>
</tr>
</table>
</td></tr>
</table>
<br><br>
<br><br>
<hr>
<hr>
=<font color="green">0.Body</font>=
 
:'''Construction of the body of Biomolecular Rocket'''<br>
=<font color="green">0. Construction of Biomolecular Rocket</font>=
:&nbsp;&nbsp;&nbsp;&nbsp;Rocket is consisted of 10μm beads, platinum or catalase, and DNA. By using DNA, platinum or catalase particles are conjugated to 10μm beads. Beads have been addressed by the deposition of gold and chromium, so DNA was able to conjugate to beads region-specific. In addition, we designed the photoresponsive DNA for allowing detachment of the engines from the Biomolecular rocket’s body upon the UV light irradiation in a region-specific manner. <br>
{|style="margin-left:35px" width="930px"
:&nbsp;&nbsp;&nbsp;&nbsp;In this section, we examined 5 experiments.
|<html><body><font size="5">We constructed Biomolecular Rocket with a microbead, catalysts, and designed DNAs.</font></body></html><br>
{|style="background-color:#00FF7F;height:140px;margin-left:10px"
&nbsp;&nbsp;&nbsp;&nbsp;Biomolecular Rocket is composed of a micrometer-sized body and many catalytic engines. The body consists of a microbead with a diameter of 10 μm, and catalytic engines consist of platinum nanoparticles or catalase molecules. The catalytic engines are conjugated to the body using a DNA-based linker in a spatially selective manner.<br>
|style="width:190px"|<div align="center"><HTML><A href=#Vapor_deposition_of_Au_and_Cr_on_the_polystyrene_body title="Vapor deposition"><IMG border="1" width="190px" src="http://openwetware.org/images/a/a5/Vapor_deposition.jpg"></A></HTML></div>
&nbsp;&nbsp;&nbsp;&nbsp;We constructed the Biomolecular Rocket through the following four steps.
|style="width:190px"|<div align="center"><HTML><A href=#DNA_design title="DNA design"><IMG width="190px" src="http://openwetware.org/images/b/b2/DNA_design.jpg"></td></A></HTML></div>
{|width="730px" border="3"
|style="width:190px;"|<div align="center"><HTML><A href=#DNA_conjugation title="EDAC conjugation"><IMG border="1" width="190px" src="http://openwetware.org/images/3/3d/EDAC_conjugation.jpg"></A></HTML></div>
|<html><body><ol>
|style="width:190px"|<div align="center"><HTML><A href=#DNA_conjugation title="SAM conjugation"><IMG border="1" width="190px" src="http://openwetware.org/images/4/48/Thiol_.jpg"></td></A></HTML></div>
<li>The microbead body was selectively coated by vapor deposition of metals (Au and Cr).<br>
|style="width:190px"|<div align="center"><HTML><A href=#Catalyst_conjugation_by_DNA_hybridization title="Conjugation catalyst"><IMG width="190px" src="http://openwetware.org/images/1/19/Conjugation_catalyst.jpg"</A></HTML></div>
<li>We designed DNA sequences for spatially-selective hybridization of catalytic engines.<br>
<li>The DNA molecules were conjugated to a designated metal surface of the microbead body.<br>
<li>Catalyst engines were attached to the microbead body with selective hybridization of DNAs we designed.</ol></body></html>
|}
|}
<div align = "right" style="padding-right:200px">[[#TOP|]]</div>
&nbsp;&nbsp;&nbsp;&nbsp;>>see more [[Biomod/2012/Titech/Nano-Jugglers/Methods_of_Biomolecular_Rocket|methods]]
<br>
<br>
==Vapor deposition of Au and Cr on the polystyrene body==
|<html><body><td align="center"><img src="http://openwetware.org/images/4/4d/Charts.jpg" border=0 width=200 height=440></a></td></body></html>
|}
==0.1. Selective coating of the body==
:{|
:{|
|<html><body><font size="5">We succeeded in selective coating of a micrometer-sized bead by vapor deposition of Au and Cr.</font></body></html><br>
>>see more [[Biomod/2012/Titech/Nano-Jugglers/Methods/selective_coating|methods]]<br><br>
|<html><body><td align="center"><img src="http://openwetware.org/images/a/a5/Vapor_deposition.jpg" border=0 width=330 height=110></a></td></body></html>
|}
:&nbsp;&nbsp;&nbsp;&nbsp;Figure 0.1a, b and c are microscope images of 40 μm microbeads. Figure 0.1a shows microbeads before vapor deposition of metals. Figure 0.1b shows microbeads after vapor deposition of Au (gold) on the microbeads. Figure 0.1c shows microbeads after additional vapor deposition of Cr (chromium) on the Au-deposited microbeads. The microbeads had three types of surface areas because the angular alignment of the beads was changed when Cr was deposited on the Au-deposited microbeads.
:&nbsp;&nbsp;&nbsp;&nbsp;Similarly, Figure 0.1e, f and g are microscope images of 10 μm microbeads. Figure 0.1e shows microbeads before vapor deposition of metals. Figure 0.1f shows microbeads after vapor deposition of Au on the microbeads. Figure 0.1g shows microbeads after additional vapor deposition of Cr on the Au-deposited microbeads. The 10 μm microbeads probably had three types of surface areas. From these results, we conclude that selective coating of microbeads for the Biomolecular Rocket was achieved.
{|style="margin-left:30px" width="930px"position:fixed;z-index:-9999;top:0;left:0;min-width:100%;min-height:100%"" border="1"
|&nbsp;&nbsp;<html><body><nobr>40 μm silica beads</nobr></body></html>
|&nbsp;&nbsp;&nbsp;&nbsp;'''a'''<br>[[Image:BIOMODTNJPVDR1.jpg|40 μm silica beads|240px]]
|&nbsp;&nbsp;&nbsp;&nbsp;'''b'''<br>[[Image:BIOMODTNJPVDR3.jpg|After first deposition|240px]]
|&nbsp;&nbsp;&nbsp;&nbsp;'''c'''<br>[[Image:BIOMOD_VD.jpg‎ |After second deposition|240px]]
|-
|-
|<html><body><td align="center" width="300px"><img src="http://openwetware.org/images/a/a5/Vapor_deposition.jpg" border=0 width=300 height=240></a></td></body></html>
|&nbsp;&nbsp;<html><body><nobr>10 μm polystyrene beads</nobr></body></html>&nbsp;&nbsp;
|&nbsp;&nbsp;&nbsp;&nbsp;We succeeded in  '''selective coating of polystyrene beads by vapor deposition of Au and Cr'''.<br><br>&nbsp;&nbsp;&nbsp;&nbsp;In this project, gold and chromium were deposited on the polystyrene beads in order to conjugate specific DNA onto the determined location on the surface.
|&nbsp;&nbsp;&nbsp;&nbsp;'''d'''<br>[[Image:10umbfAuVD.jpg|10 μm polystyrene beads|240px]]
:>>see [[Biomod/2012/Titech/Nano-Jugglers/Methods#Vapor_deposition_of_Au_and_Cr_on_the_polystyrene_body|Method]]
|&nbsp;&nbsp;&nbsp;&nbsp;'''e'''<br>[[Image:10umafAuVD.jpg|After first deposition|240px]]
|&nbsp;&nbsp;&nbsp;&nbsp;'''f'''<br>[[Image:10umafCrVD.jpg|After second deposition|240px]]
|-
|-
|&nbsp;&nbsp;<html><body><nobr>Image of micro-beads</nobr></body></html>
|<html><body><img src="http://openwetware.org/images/d/d5/Polystyrene.jpg" border=0 width=240 height=180></body></html>
|<html><body><img src="http://openwetware.org/images/4/41/After_first_deposition.jpg" border=0 width=240 height=180></body></html>
|<html><body><img src="http://openwetware.org/images/3/30/After_second_deposition.jpg" border=0 width=240 height=180></body></html>
|-
|colspan="4"|&nbsp;&nbsp;&nbsp;&nbsp;Fig. 0.1 Selective coating of micro-beads by vapor deposition.
|}
|}
:{| border="1"
 
|'''Image1'''
==0.2. Design of linker DNA strands==
|'''Image2'''
:<html><body><font size="5">We designed DNA sequences for the linkers to attach catalytic engines to the microbead body.</font></body></html>
|'''Image3'''
:>>see more [[Biomod/2012/Titech/Nano-Jugglers/Methods/DNA_Design|methods]]
|'''Image4'''
{|style="margin-left:35px" width="920px"
|&nbsp;&nbsp;&nbsp;&nbsp;We designed two kinds of DNA sequences with different stability. One is DNA sequence L. This sequence forms a very stable duplex with its complementary sequence L<sup>*</sup> at a room temperature. Another is DNA sequence S. The duplex of DNA sequence S and S<sup>*</sup> has less stability than DNA sequence L and L<sup>*</sup> but is stable at a room temperature.
|
{|width="475px" border="1"
|&nbsp;&nbsp;'''DNA sequence L <br>
&nbsp;&nbsp;<html><body><nobr>5’-CGTCTATTGCTTGTCACTTCCCC-3'&nbsp;&nbsp;</nobr></body></html>
|&nbsp;&nbsp;'''DNA sequence S<br>
&nbsp;&nbsp;<html><body><nobr>5’-AATACCCAGCC-3’&nbsp;&nbsp;</nobr></body></html>
|-
|-
|[[Image:BIOMODTNJPVDR1.jpg|Image1|220px]]
|&nbsp;&nbsp;'''DNA sequence  L<sup>*</sup><br>
|[[Image:BIOMODTNJPVDR2.jpg|Image2|220px]]
&nbsp;&nbsp;<html><body><nobr>5'-GGGGAAGTGACAAGCAATAGACG-3'&nbsp;&nbsp;</nobr></body></html>
|[[Image:BIOMODTNJPVDR3.jpg|Image3220px]]
|&nbsp;&nbsp;'''DNA sequence S<sup>*</sup> <br>
|[[Image:BIOMOD_VD.jpg‎ ||image4|220px]]
&nbsp;&nbsp;<html><body><nobr>5’-GGCTGGGTATT-3'&nbsp;&nbsp;</nobr></body></html>
|-
|}
|40 micron polystyrene beads
|40 micron polystyrene beads with completely covered by gold
|40 micron silica beads with half vapor deposition of gold
|40 µm polystyrene beads is covered three-quarter of the surface by gold and chromium.
|}
|}
:&nbsp;&nbsp;&nbsp;&nbsp;From these pictures, we observed that vapor deposition can make hemisphere membrane of gold. By comparing the color of figure1 and figure2, micro-beads completely covered by gold are more black and have a metallic luster. From figure3 , it is possible that the 40μm beads can deposit gold as hemisphere in that the colors of beads sphere’s limbs are different. Figure 4 shows that the 40μm beads was covered by two metals which are gold and chromium.We succeeded in dividing the surface of the beads for three parts such as  polystyrene, gold and chromium.  
:&nbsp;&nbsp;&nbsp;&nbsp;Figure 0.2a and 0.2b show calculated melting profiles of duplexes L-L<sup>*</sup> and S-S<sup>*</sup>, respectively. Calculated melting temperatures of these duplexes were higher than  a room temperature.
:{| border="1"
{|style="margin-left:35px" border="1"
|'''Image5'''
|&nbsp;&nbsp;'''a'''<br>[[Image:SeqA&seqAc2_melt.png|DNA Tm|450px]]
|'''Image6'''
|&nbsp;&nbsp;'''b'''<br>[[Image:SeqB&seqBc_melt.png|Photoresponsive DNA Tm|450px]]
|'''Image7'''
|-
|-
|[[Image:10umbfAuVD.jpg|220px]]
|style="padding:10px" colspan="2" |Fig. 0.2. (a) The melting profile of duplex L-L<sup>*</sup>. (b) The melting profile of duplex S-S<sup>*</sup>. RT and ''T''<sub>m</sub> indicate a room temperature (24°C) and a melting temperature, respectively. We calculated the melting profiles using NUPACK software.
|[[Image:10umafAuVD.jpg|220px]]
|[[Image:10umafCrVD.jpg|220px]]
|-
|10µm polystyrene beads was spread on the cover glass in a single layer.  
|This image is 10µm polystyrene beads. After gold deposition, a hemisphere of the beads is covered gold.
|After chromium deposition, the three quarter surface of beads was covered by chromium and gold.
|}
|}
:&nbsp;&nbsp;&nbsp;&nbsp;We experimented not just 40µm polystyrene beads but also 10µm polystyrene beads. The more beads smaller, the more difficult to confirm whether beads is covered metal or not. Image5 show that 10µm polystyrene beads was spread on the cover glass in a single layer. Image6 show 10µm polystyrene beads. After gold deposition, a hemisphere of the beads is covered gold. we put the beads on a ethanol solution and confided whether beads was covered or not. As a result, we confirmed right bead in this image is covered by gold.  A left bead in this image is also covered by gold, but a gold surface of the bead was the upper side, so we couldn't observe a boundary between gold surface and polystyrene surface. After chromium deposition, the half surface of the beads was covered  by chromium, and the quarter surface of the beads covered  by gold. However, it is difficult to observe a range of metal surface.   
 
:&nbsp;&nbsp;&nbsp;&nbsp;From this result, we would able to detach catalytic engine specifically from the body of Biomolecular Rocket. And this makes the body of Biomolecular Rocket and controls their direction.
==0.3. Selective DNA conjugation to the microbead body of Biomolecular Rocket==
<div align = "right" style="padding-right:200px">[[#TOP|↑]]</div>
===0.3.1. Selective conjugation of DNA to polystyrene surface area===
==DNA design==
:<hr>
:{|
:{|
|-
|-
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/b/b2/DNA_design.jpg" border=0 width=300 height=240></a></td></body></html>
|<html><body><td align="center"><img src="http://openwetware.org/images/f/f5/Polystyrene_EDAC.jpg" border=0 width=300 height=240></a></td></body></html>
|
|<html><body><font size="5">We succeeded in selective DNA conjugation to the polystyrene surface area  of the microbead body.</font></body></html><br>
&nbsp;&nbsp;&nbsp;&nbsp;We '''designed nine DNA strands by using NUPACK in order to hybridize at constant temperature'''. <br><br>
>>see more [[Biomod/2012/Titech/Nano-Jugglers/Methods/Polystyrene_conjugation|methods]]<br><br>
:>>see [[Biomod/2012/Titech/Nano-Jugglers/Methods#DNA_design|Method]]
&nbsp;&nbsp;&nbsp;&nbsp;We conjugated amino-modified DNA sequence L<sup>*</sup> to the calboxylated polystyrene surface area of the microbead body with amide binding. To investigate the selective conjugation of L<sup>*</sup>, we hybridized a fluorophore-modified DNA sequence L with L* on the body and observed the DNA-conjugated microbead bodies.
|}
|}
:&nbsp;&nbsp;&nbsp;&nbsp;We selected two DNA strands from a treatise. In the below, there are two DNA strands.
:&nbsp;&nbsp;&nbsp;&nbsp;Figure 0.3.1a, b, and c are bright-field microscope images of selectively-coated microbead bodies (10 μm in diameter). Figure 0.3.1a', b', and c' are fluorescence microscope images of the selectively-coated microbead bodies. Figure 0.3.1a and a' shows selectively DNA-L<sup>*</sup>-conjugated microbeads with fluorophore-modified DNA L. Fluorescence of L was observed only where the polystyrene surface was exposed after the vapor deposition of metal. Figure 0.3.1b and b' shows selectively DNA-L<sup>*</sup>-conjugated microbeads without fluorophore-modified DNA L, and no fluorescence was observed. Figure 0.3.1c and c' shows non-DNA-conjugated microbeads with fluorophore-modified DNA L, and no fluorescence was observed. From these results, we conclude that selective conjugation of DNA L<sup>*</sup> to polystyrene surface area of the microbead bodies was achieved.
 
:&nbsp;&nbsp;&nbsp;&nbsp;5’-GCATCTACACTCAATACCCAGCC-3’
:&nbsp;&nbsp;&nbsp;&nbsp;5’-CGTCTATTGCTTGTCACTTCCCC-3’
 
:&nbsp;&nbsp;&nbsp;&nbsp;And then, we adjusted number of bases of the DNA strands. This is because we need to dissociate DNA strands easily as to control Biomolecular Rocket by detaching catalytic engines from the body. As a result, we adjusted one DNA strand to 11 bases from 23 bases.
 
:&nbsp;&nbsp;&nbsp;&nbsp;seqA' 5’-GCATCTACACTCAATACCCAGCC-3’
:&nbsp;&nbsp;&nbsp;&nbsp;seqA 5’-AATACCCAGCC-3’
 
:&nbsp;&nbsp;&nbsp;&nbsp;Four azobenzene molecules is incorporated into this DNA strand for photo switching. We also designed complementary DNA strands.
 
:&nbsp;&nbsp;&nbsp;&nbsp;seqA 5’-AATACCCAGCC-3’
:&nbsp;&nbsp;&nbsp;&nbsp;seqAc 5’-GGCTGGGTATT-3’
 
:&nbsp;&nbsp;&nbsp;&nbsp;seqB 5’-CGTCTATTGCTTGTCACTTCCCC-3’
:&nbsp;&nbsp;&nbsp;&nbsp;seqBc 5'-GGGGAAGTGACAAGCAATAGACG-3'
 
:&nbsp;&nbsp;&nbsp;&nbsp;We analyzed melting temperature of DNA hybridization of each DNA strand and complementary DNA strand. Result of analysis is below.
 
:&nbsp;&nbsp;&nbsp;&nbsp;[[Image:SeqA&seqAc2_melt.png|300px]][[Image:SeqB&seqBc_melt.png|300px]]
 
:&nbsp;&nbsp;&nbsp;&nbsp;In addition, we modified amino group to DNA strands for conjugation onto a polystyrene surface. And we also modified thiol group to DNA strands for conjugation onto a gold and platinum surface.
 
:{| border="1"
:{| border="1"
|'''seqA_5thiol
|&nbsp;&nbsp;<html><body><nobr>Bright-field microscope images</nobr></body></html>&nbsp;&nbsp;
|[ThiSS]AATXACXCCXAGXCC
|&nbsp;&nbsp;&nbsp;&nbsp;'''a'''&nbsp;&nbsp;&nbsp;&nbsp;<br>[[Image:BIOMOD-TNJ-CrAu_1_2.jpg|DNA conjugated beads and FAM|220px]]
|&nbsp;&nbsp;&nbsp;&nbsp;'''b'''&nbsp;&nbsp;&nbsp;&nbsp;<br>[[Image:BIOMOD-TNJ-CrAu_2.jpg|DNA conjugated beads|220px]]
|&nbsp;&nbsp;&nbsp;&nbsp;'''c'''&nbsp;&nbsp;&nbsp;&nbsp;<br>[[Image:BIOMOD-TNJ-CrAu_3.jpg|Beads and FAM|220px]]
|-
|-
|'''seqAc_5thiol
|&nbsp;&nbsp;<html><body><nobr>Fluorescence microscope images</nobr></body></html>&nbsp;&nbsp;
|[ThiSS]GGCTGGGTATT
|&nbsp;&nbsp;&nbsp;&nbsp;'''a''''&nbsp;&nbsp;&nbsp;&nbsp;<br>[[Image:BIOMOD-TNJ-CrAu_1_2_2s.jpg|DNA conjugated beads and FAM|220px]]
|&nbsp;&nbsp;&nbsp;&nbsp;'''b''''&nbsp;&nbsp;&nbsp;&nbsp;<br>[[Image:BIOMOD-TNJ-CrAu_2_2s.jpg|DNA conjugated beads|220px]]
|&nbsp;&nbsp;&nbsp;&nbsp;'''c''''&nbsp;&nbsp;&nbsp;&nbsp;<br>[[Image:BIOMOD-TNJ-CrAu_3_2s.jpg|Beads and FAM|220px]]
|-
|-
|'''seqB_5thiol
|&nbsp;&nbsp;<html><body><nobr>Experimental conditions<nobr></body></html>&nbsp;&nbsp;
|[ThiSS]CGTCTATTGCTTGTCACTTCCCC
|<html><body><img src="http://openwetware.org/images/d/d3/EDACBEADS1.JPG" border=0 width=220 height=120></a></body></html>
|<html><body><img src="http://openwetware.org/images/3/38/EDACBEADS2.JPG" border=0 width=220 height=120></a></body></html>
|<html><body><img src="http://openwetware.org/images/2/23/EDACBEADS3.JPG" border=0 width=220 height=120></a></body></html>
|-
|-
|'''seqBc_5amino
|style="padding:10px" colspan="4"|Fig. 0.3.1 Microscope images of the microbead bodies of Biomolecular Rocket. (a) and (a') Selectively DNA-conjugated microbeads with complementary fluorophore-modified DNA. (b) and (b') Selectively DNA-conjugated microbeads without complementary fluorophore-modified DNA. (c) and (c') non-DNA-conjugated microbeads with complementary fluorophore-modified DNA.
|[AminoC6]GGGGAAGTGACAAGCAATAGACG
|}
|}


:&nbsp;&nbsp;&nbsp;&nbsp;Moreover, we designed DNA strands that have linker part.
===0.3.2. Selective conjugation of DNA to metal surface area===
 
:<hr>
:{| border="1"
:{|
|'''seqAc_5thiol_T15
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/8/87/Metal_SAM.jpg" border=0 width=300 height=240></a></td></body></html>
|[ThiSS]TTTTTTTTTTTTTTTGGCTGGGTATT
|<html><body><font size="5">We succeeded in selective DNA conjugation to the Au surface area of the microbead body.</font></body></html><br>
>>see more [[Biomod/2012/Titech/Nano-Jugglers/Methods/Metal_area|methods]]<br><br>
&nbsp;&nbsp;&nbsp;&nbsp;We conjugated thiol-modified DNA sequence S<sup>*</sup> to the Au surface area of the microbead body with Au-thiol bonding. To confirm the selective conjugation of S<sup>*</sup> to an Au surface, we observed an Au-deposited cover glass after DNA conjugation instead of selectively Au-coated microbeads after DNA conjugation. We investigated the wetting properties of the Au surface before and after DNA conjugation because the wetting investigation showed the selective conjugation of DNA more clearly than the fluorescence observation like Fig. 0.3.1.
|}
:&nbsp;&nbsp;&nbsp;&nbsp;Figure 0.3.2a shows the Au glass plate with a non-DNA spot (1), a non-thiol-modified DNA spot (2), and a thiol-modified DNA spot (3). Only at the spot (3), residual water was observed. The water remained by the wetting property of the spot (3); the higher wetting property of spot (3) than those of spots (1) and (2) was expected to be caused by the Au surface with thiol-modified DNA conjugation. Therefore, we conclude that selective conjugation of thiol-modified DNA to the Au surface area of the microbead body was also achieved.
{|style="margin-left:80px" width="800px" border="1"
|&nbsp;&nbsp;&nbsp;&nbsp;'''a'''&nbsp;&nbsp;&nbsp;&nbsp;<br>[[Image:金板3.jpg|Au plate|400px]]
|&nbsp;&nbsp;&nbsp;&nbsp;'''b'''&nbsp;&nbsp;&nbsp;&nbsp;<br>[[Image:%E8%A7%A3%E8%AA%AC.jpg|condition|400px]]
|-
|-
|'''seqB_5thiol_T15
|colspan="2"|&nbsp;&nbsp;&nbsp;&nbsp;'''c'''<br><html><body><img src="http://openwetware.org/images/1/1a/Auplate1.jpg" border=0 width=800 height=150></a></body></html>
|[ThiSS]TTTTTTTTTTTTTTTATTGCTTGTCACTTCCCC
|-
|-
|'''seqBc_5amino_T15
|style="padding:10px" colspan="2"|Fig. 0.3.2. (a) An Au glass plate with a non-DNA spot (1), a non-thiol-modified DNA spot (2), and a thiol-modified DNA spot (3). <br>(b) A layout drawing of the spots (1)-(3). <br>(c) Experimental condition for the spots (1)-(3).
|[AminoC6]TTTTTTTTTTTTTTTAGTGACAAGCAATAGACG
|}
|}


:&nbsp;&nbsp;&nbsp;&nbsp;Finally, we designed FAM modified DNA strands for confirming to success experiments of EDAC conjugation and thiol conjugation.
==0.4. Catalyst attachment with DNA hybridization==
 
:{|
:{| border="1"
|'''seqB_5FAM
|[6-FAM]CGTCTATTGCTTGTCACTTCCCC
|-
|-
|'''seqBc_5FAM
|<html><body><td align="center"><img src="http://openwetware.org/images/1/19/Conjugation_catalyst.jpg" border=0 width=300 height=230></a></td></body></html>
|[6-FAM]GGGGAAGTGACAAGCAATAGACG
|<html><body><font size="5">Catalyst engines are attached to the microbead body of Biomolecular Rocket with DNA hybridization reactions between L and L<sup>*</sup>, and S and S<sup>*</sup>.</font></body></html><br>
>>see more [[Biomod/2012/Titech/Nano-Jugglers/Methods/Conjugation_catalyst|methods]]<br><br>
|}
|}
:&nbsp;&nbsp;&nbsp;&nbsp;From the results of sections 0.1 and 0.3, a selectively DNA-conjugated microbead body of Biomolecular Rocket is constructed. In addition, we prepared catalytic engines with DNA-tag sequences (L and S) that are complementary to the DNA sequences (L<sup>*</sup> and S<sup>*</sup>) on the body. Therefore, by mixing the DNA-tagged catalytic engines and selectively DNA-conjugated body, Biomolecular Rocket would be constructed in a self-assembled manner. Experiments are currently in progress.
<br><br>
<div align = "right" style="padding-right:20px">[[#TOP|↑Page Top]]</div>
<hr>


:&nbsp;&nbsp;&nbsp;&nbsp;On the below, there are all DNA strands we designed.
=<html><body><font color="red">1. Power supply for the rail-free movement of the Biomolecular Rocket</font></body></html>=
 
:<html><body><font size="5">We achieved the power supply for the rail-free movement of the Biomolecular Rocket.</font></body></html>
:{|
{|style="margin-left:35px"
|&nbsp;&nbsp;&nbsp;&nbsp;We utilized H<sub>2</sub>O<sub>2</sub> for fuel and catalysts of H<sub>2</sub>O<sub>2</sub> for catalytic engines to realize the rail-free movement of the Biomolecular Rocket. Catalysts such as platinum and catalase catalyze the decomposition of H<sub>2</sub>O<sub>2</sub> into H<sub>2</sub>O and O<sub>2</sub>; emitted bubbles of O<sub>2</sub> launch Biomolecular Rocket.
&nbsp;&nbsp;&nbsp;&nbsp;Here, we investigated the following points to realize the power supply for the rail-free movement of the Biomolecular Rocket.<br>
{|border="3" width="690px"
|<html><body><ol>
<li>We found that catalase molecules as catalytic engines could emit sufficient amount of bubbles for the rail-free movement.
<li>We found that platinum particles as a catalytic engines could emit sufficient amount of bubbles for rail-free movement.
<li>We found that the H<sub>2</sub>O<sub>2</sub> did not affect the stability of DNA linkers for attaching catalytic engines to the body in the H<sub>2</sub>O<sub>2</sub> solution.
</ol></body></html>
|}
|<html><body><td align="center"><img src="http://openwetware.org/images/b/b3/WikiRFBM.jpg" border=0 width=240 height=240></a></td></body></html>
|}
==1.1. Power supply for rail-free movement by using catalase catalytic engine==
:<html><body><font size="5">We succeeded in the rail-free movement by O<sub>2</sub> bubble emission with catalase.</font></body></html>'''<br>
:&nbsp;&nbsp;&nbsp;&nbsp;We utilized the catalase for catalytic engines, which catalyzes the decomposition of H<sub>2</sub>O<sub>2</sub> into H<sub>2</sub>O and O<sub>2</sub>. Here, we conjugated the catalase to the polystyrene area of a microbead with a hemispherical Au surface and a hemispherical polystyrene surface (Fig. 1.1).
:>>see more [[Biomod/2012/Titech/Nano-Jugglers/Methods/Varification_catalase|methods]]<br><br>
:&nbsp;&nbsp;&nbsp;&nbsp;Movie 1.1 shows the rail-free movement of a 10 μm microbead with a hemispherical Au surface and a hemispherical polystyrene surface by O<sub>2</sub> bubble emission with catalase. The 10 μm beads without catalase did not move at all (Movie 1.2). Thus, we conclude that we succeeded in the rail-free movement by O<sub>2</sub> bubble emission with catalase.
{|style="margin-left:35px"
|
{|width="320px" border="1"
|<html><body><img src="http://openwetware.org/images/1/1b/Crf.jpg" border=0 width=420 height=315></body></html>
|-
|-
*The DNA strands
|style="padding:10px"|Fig. 1.1&nbsp;&nbsp;Image of a microbead with a hemispherical Au surface and a hemispherical polystyrene surface in 3% H<sub>2</sub>O<sub>2</sub> solution.
:{| border="1"
|}
|'''seqA_azo4_5thiol
|
|[ThiSS]AATXACXCCXAGXCC (X=Azobenzene)
{|border="1" width="420px"
|-
|<HTML><iframe width="420" height="315" src="http://www.youtube.com/embed/Ie2dUHcwZN0" frameborder="0" allowfullscreen></iframe></HTML>
|'''seqAc_5thiol
|[ThiSS]GGCTGGGTATT
|-
|'''seqAc_5thiol_T15
|[ThiSS]TTTTTTTTTTTTTTTGGCTGGGTATT
|-
|'''seqB_5thiol
|[ThiSS]CGTCTATTGCTTGTCACTTCCCC
|-
|'''seqB_5thiol_T15
|[ThiSS]TTTTTTTTTTTTTTTATTGCTTGTCACTTCCCC
|-
|'''seqB_5FAM
|[6-FAM]CGTCTATTGCTTGTCACTTCCCC
|-
|'''seqBc_5amino
|[AminoC6]GGGGAAGTGACAAGCAATAGACG
|-
|'''seqBc_5amino_T15
|[AminoC6]TTTTTTTTTTTTTTTAGTGACAAGCAATAGACG
|-
|-
|'''seqBc_5FAM
|style="padding:10px"|Movie. 1.1&nbsp;&nbsp;&nbsp;The real-time video of the moving 10 μm bead with a catalase-conjugated hemisphere area in 3% H<sub>2</sub>O<sub>2</sub> solution.
|[6-FAM]GGGGAAGTGACAAGCAATAGACG
|}
|}
::&nbsp;&nbsp;&nbsp;&nbsp;(The DNA strands selected by us.)
|}
|}
<div align = "right" style="padding-right:200px">[[#TOP|]]</div>
 
==DNA conjugation==
==1.2. Power supply for rail-free movement by using platinum catalytic engine==
===EDAC conjugation===
:<html><body><font size="5">We achieved bubble emissions with platinum micro-particles in solution of H<sub>2</sub>O<sub>2</sub>.</font></body></html><br>
:{|
:&nbsp;&nbsp;&nbsp;&nbsp;We provided 1 μm platinum particles, and Cr coating to create platinum hemispherical area. Then added 3% H<sub>2</sub>O<sub>2</sub> solution and observed their movement.
:>>see more [[Biomod/2012/Titech/Nano-Jugglers/Methods/Varification_platinum|methods]]<br><br>
:&nbsp;&nbsp;&nbsp;&nbsp;Movie 1.2 reveals the catalytic reaction of 3% H<sub>2</sub>O<sub>2</sub> and 1 μm beads that have platinum hemispherical area. We can recognize that bubbles are emitted in H<sub>2</sub>O<sub>2</sub> solution. These bubbles are emitted from 1 μm beads that have platinum hemispherical area by decomposing H<sub>2</sub>O<sub>2</sub>. From this result, we conclude that power supply for rail-free movement by using platinum catalytic engine was achieved.
{|style="margin-left:35px"
|
{|width="420px" border="1"
|<html><body><img src="http://openwetware.org/images/8/89/Simple_beads.jpg" border=0 width=420 height=315></a></body></html>
|-
|-
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/3/3d/EDAC_conjugation.jpg" border=0 width=300 height=240></a></td></body></html>
|style="padding:10px"|Fig. 1.2 Image of a microbead with a hemispherical Cr surface and a hemispherical platinum surface in 3% H<sub>2</sub>O<sub>2</sub> solution.
|&nbsp;&nbsp;&nbsp;&nbsp;We succeeded in '''amino modified DNA conjugation to polystyrene surface by EDAC conjugation'''.<br>
&nbsp;&nbsp;&nbsp;&nbsp;We bond polystyrene-beads with DNA using EDAC. To confirm that amino modified DNA is bind to polystyrene, we hybridize the DNA with FAM and observe them under blue light by microscope.
:>>see [[Biomod/2012/Titech/Nano-Jugglers/Methods#EDAC_conjugation|Method]]
|}
|}
:{| border="1"
|
|Added Reagent
{|border="1" width="420"
|1,Polystyren beads<br>2,DNA which bind with beads<br>3,Complementary FAM DNA
|
|1,Polystyren beads<br>2,DNA which bind with beads<br><br>
<HTML><iframe width="420" height="300" src="http://www.youtube.com/embed/gPNaMMd3NP4" frameborder="0" allowfullscreen></iframe></HTML>
|1,Polystyren beads<br><br>3,Complementary FAM DNA
|-
|Under Transmitted Light
|[[Image:BIOMOD-TNJ-CrAu_1_2.jpg|250px]]
|[[Image:BIOMOD-TNJ-CrAu_2.jpg|250px]]
|[[Image:BIOMOD-TNJ-CrAu_3.jpg|250px]]
|-
|Under Blue Light
|[[Image:BIOMOD-TNJ-CrAu_1_2_2s.jpg|250px]]
|[[Image:BIOMOD-TNJ-CrAu_2_2s.jpg|250px]]
|[[Image:BIOMOD-TNJ-CrAu_3_2s.jpg|250px]]
|-
|-
|Fluorescence
|style="padding:10px"|Movie. 1.2 &nbsp;&nbsp;&nbsp;&nbsp;Image of the catalytic reaction of 3% H<sub>2</sub>O<sub>2</sub> and 1 μm beads that have platinum hemispherical area.
|'''Observed'''
|}
|'''Not observed'''
|'''Not observed'''
|}
|}
:&nbsp;&nbsp;&nbsp;&nbsp;Polystyrene beads which were treated with EDAC conjugation exhibited fluorescence, on the othr hand polystyrene beads which were not treated with EDAC conjugation didn't exhibit fluorescence. this is because EDAC treated beads could hybridize Complementary FAM DNA. The othr beads couldn't hybridize FAM DNA in that there were no surface area that could be conjugated to.<br>
 
:&nbsp;&nbsp;&nbsp;&nbsp;These pictures shows that we succeeded in amino modified DNA conjugation to polystyrene surface by EDAC conjugation.
==1.3. DNA hybridization in solution of H<sub>2</sub>O<sub>2</sub>==
:{|
:<html><body><font size="5">We revealed that diluted H<sub>2</sub>O<sub>2</sub> solutions did not affect DNA hybridization and a H<sub>2</sub>O<sub>2</sub> solution was suitable for a fuel for the Biomolecular Rocket. </font></body></html><br>
:>>see more [[Biomod/2012/Titech/Nano-Jugglers/Methods/DNA_hybridization|methods]]<br><br>
:&nbsp;&nbsp;&nbsp;We confirmed that DNA duplexes were stably formed in diluted H<sub>2</sub>O<sub>2</sub> solutions by the native polyacrylamide gel electrophoresis (PAGE). Figure 1.3 shows the gel image of the PAGE. As shown in the lanes 1-3, a double-stranded DNA was formed in 1% and 5% H<sub>2</sub>O<sub>2</sub> solutions.
:{|style="margin-left:100px" width="700px" border="1"
|[[Image:BIOMODTNJEPR 04.JPG|Electrophoresis|700px]]
|-
|-
|[[Image:EDAC_conjugation.jpg|400px]]
|style="padding:10px"|Fig. 1.3&nbsp;&nbsp;&nbsp; A gel image of a native PAGE of DNA in H<sub>2</sub>O<sub>2</sub> solutions. Lanes 1-3, 8: a double stranded DNA (D+R) in diluted H<sub>2</sub>O<sub>2</sub> solutions eith concentrations 0% (lanes 1 and 8), 1% (lane 2), and 5% (lane 3). In lanes 4-7, single stranded DNAs in 0% and 5% H<sub>2</sub>O<sub>2</sub> solutions were shown. DNA sequences R and D are shown at the upper right of the image.
|※We use polystyrene beads whose 1/4 was covered with Gold and 1/2 was covered with chromium. Fluorescence was observed only polystyrene area that EDAC conjugated, so fluorescence was skewed. In other words, from this photo, we confirm that we have been successful of selective coating by vapor deposition. Fluorescence was not observed which did not bind the EDAC conjugation. From this result, we concluded that amino modified DNA is bind to polystyrene area.
'''Observation Conditions'''
ISO6400<br>
Exposure time(Transmitted Light)1/100 seconds<br>
Exposure time(Blue Light)2seconds<br>
Magnification  10×40=400<br>
|}
|}
<div align = "right" style="padding-right:200px">[[#TOP|]]</div><hr>
<br><br><div align = "right" style="padding-right:20px">[[#TOP|↑Page Top]]</div>
===SAM conjugation===
<hr>
:{|
 
|-
=<font color="blue">2. Realization of the high-speed movement of the Biomolecular Rocket</font>=
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/4/48/Thiol_.jpg" border=0 width=300 height=240></a></td></body></html>
:<html><body><font size="5">We confirmed the high-speed movement of the Biomorecular Rocket by bubble emission.</font></body></html><br><br>
|&nbsp;&nbsp;&nbsp;&nbsp;We succeeded in  '''thiol modified DNA conjugation onto gold surface by SAM'''.<br>
{|style="margin-left:35px"
&nbsp;&nbsp;&nbsp;&nbsp;Self-assembled monolayers (SAM) of molecules are molecular assemblies formed spontaneously on substrate surfaces by chemical adsorption. this reaction enabled us to conjugate DNA onto gold and/or platinum surface.
|&nbsp;&nbsp;&nbsp;&nbsp;Catalytic engines emit large amount of bubbles, and thus, supply powerful driving force to the Biomolecular Rocket. By the analyses of the movement of platinum particles and numerical simulations, we found that the speed of the Biomolcular Rocket was faster than that of kinesin. We carried out the experiments and simulations as follows.
:>>see [[Biomod/2012/Titech/Nano-Jugglers/Methods#SAM_conjugation|Method]]
{|border="3" width="630px"
|-
|<html><body><ol>
<li>Observations of the movement of platinum particles using a high-speed camera and analyses of the speed
<li>Numerical simulations of the movement of the Biomolecular Rocket</ol></body></html>
|}
|}
:{|style="margin-left:0px"
 
|-
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/7/7a/%E8%A7%A3%E8%AA%AC.jpg" border=0 width=500 height=400></a></td></body></html>
|
|
&nbsp;&nbsp;&nbsp;&nbsp;Image1 shows the state of thiol-modified DNA and gold-deposited cover glass reaction. Spot 1 and 4 are phosphate and saline buffer. Spot 2 and 5 are phosphate and saline buffer that DNA was dissolved in. Spot 3 and 6 are phosphate and saline buffer that thiol-modified DNA was dissolved. Final concentration of phosphate and saline buffer are the same in these spot. But 1、2 and 3 are added NaCl concentration immediately after 24 hours of incubation. On the other hand 4, 5, and 6 are intended to raise the concentration of NaCl every 2 hours after 24 hours of incubation for 6hours, then incubate more 16hours. In image2, gold-deposited cover glass is washed with 3 × SSC, then it was blotted on the surface of the water.  
<html><body><img src="http://openwetware.org/images/2/26/Hst.jpg" width=300 height=230></body></html>
|}
|}
:&nbsp;&nbsp;&nbsp;&nbsp;We observe that there were few signs after washing in 1,2,4 and 5.On the other hand, 3 and 6 were left water. This is expected that this spot of gold surface is covered with DNA by thiol conjugation, and became partially hydrophilic. Other spots are still hydrophobic in that there are no conjugations of DNA.
==2.1. Power supply for the high-speed movement with platinum catalytic engines==
:&nbsp;&nbsp;&nbsp;&nbsp;From this result, we were determined that thiol conjugation is completed.
:<html><body><font size="5">We succeeded in high speed movement with platinum catalytic engines.</font></body></html>
:{| border="1"
:>>see more [[Biomod/2012/Titech/Nano-Jugglers/Methods/High-speed_camera|methods and full length movie]]<br><br>
|'''
:&nbsp;&nbsp;&nbsp;&nbsp;Movie 2.1.1a shows the movement of 0.15-0.40 μm platinum particles in 3% H<sub>2</sub>O<sub>2</sub> solution. Movie 2.1.1b is the movement of platinum particles observed by a high-speed camera (the upper left of the movie) and its analyzed results (the right of the movie). The analyzed results show the values of acceleration (top), velocity (the second from the top), coordinate x (third), and coordinate y (bottom) of platinum movement. From the results, we found the relationships between the growth of bubble radius and the speed of platinum. Using the relationships and the kinetic parameters, we did numerical simulations of the movement of the Biomolecular Rocket (see Section 2.2).
|'''Image1'''<br>Incubated for 48 hours at a gold plate
:&nbsp;&nbsp;&nbsp;&nbsp;Figure. 2.1.2 shows the graph of the mean square displacement of the platinum particle. We can calculate mean speed of platinum particle by making a quadratic curve fitting and calculating square root of coefficient of the curve.  We calculated that the value of quadratic coefficient was 115.5 mm<sup>2</sup>/s<sup>2</sup>, and the average speed was calculated as 10.7 mm/s. Assuming that kinesin moves at 1μm/s, Platinum particles in H<sub>2</sub>O<sub>2</sub> solution can moved at about '''''10,000 time’s faster speed than kinesin.'''''
|'''Image2'''<br>Suck out the water after incubation
 
|'''Image3'''<br>Washed away gold plate surface by 3 × SSC  after sucking out the water
:{|border = "1"
|&nbsp;&nbsp;&nbsp;'''a'''<br><HTML><iframe width="440" height="330" src="http://www.youtube.com/embed/7pBw4FWEt3I" frameborder="0" allowfullscreen></iframe></HTML><br>
|&nbsp;&nbsp;&nbsp;'''b'''<br><HTML><iframe width="440" height="330" src="http://www.youtube.com/embed/R4RsXKiknIs" frameborder="0" allowfullscreen></iframe></HTML><br>
|-
|-
|image
|style="padding:10px" colspan="2"|Movie. 2.1.1&nbsp;&nbsp;&nbsp;&nbsp;Analyses of the speed of platinum in solution of H<sub>2</sub>O<sub>2</sub>.<br>
|[[Image:金板1.jpg|270px]]
(a)&nbsp;&nbsp;Platinum movement in solution of H<sub>2</sub>O<sub>2</sub>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(b)&nbsp;&nbsp;Analyses of the speed of plutinum by High-speed camera
|[[Image:金板2.jpg|270px]]
|}
|[[Image:金板3.jpg|270px]]
{|style="margin-left:200px" width="500px" border="1"
|[[Image:Calculation speed.jpg|500px|]]
|-
|-
|condition
|&nbsp;&nbsp;Fig. 2.1.2 The mean square displacement of a platinum particle.
|
|Hydrophilic layers are stretched in spot 3 and 6
|Hydrophilic layers are still stretched in spot 3 and 6
|}
|}
<div align = "right" style="padding-right:200px">[[#TOP|↑]]</div>
 
==Catalyst conjugation by DNA hybridization==
==2.2. Numerical estimation of the speed of the Biomolecular Rocket==
:{|
:<html><body><font size="5">The numerical simulation revealed that the Biomolecular Rocket can move ten times faster than kinesin.</font></body></html><br>
|-
:>>see more [[Biomod/2012/Titech/Nano-Jugglers/Simulation|simulation models]]
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/1/19/Conjugation_catalyst.jpg" border=0 width=300 height=240></a></td></body></html>
:&nbsp;&nbsp;&nbsp;&nbsp;The simulation also demonstrated that the Biomolecular Rocket with many platinum catalysts on the body can move twice faster than a microbead with a hemispherical platinum surface moves because of the difference in the catalytic surface areas between them (Fig. 2.2).
|&nbsp;&nbsp;&nbsp;&nbsp;We tried to '''catalyst conjugation by DNA hybridization'''.<br>
:&nbsp;&nbsp;&nbsp;&nbsp;Figure 2.2 shows instantaneous speed at each time steps of kinesin motor, 10 μm beads with a hemispherical platinum surface (catalytic motor without DNA), and 10 μm of the Biomolecular Rocket. We take the average of 100 time step's instantaneous speed of each molecular motor and make a comparison among them.
&nbsp;&nbsp;&nbsp;&nbsp;DNA hybridization enable us to conjugate each materials in that DNA strand transits to take  thermodynamically stable forms.  
:&nbsp;&nbsp;&nbsp;&nbsp;As a result, the average speed of the Biomolecular Rocket is calculated as 11.2 μm/s, and the average speed of catalytic motor without DNA is 6.8 μm/s. We assumed that Kinesin moves straightforward at 1.0 μm/s all the time, Kinesin's average speed is calculated as 1.0 μm/s.  
:>>see [[Biomod/2012/Titech/Nano-Jugglers/Methods#Catalyst_conjugation_by_DNA_hybridization|Method]]
:&nbsp;&nbsp;&nbsp;&nbsp;Therefore, we estimate that the Biomolecular Rocket moves faster than kinesin. Moreover, the Biomolecular Rocket can get more speed by surface enlargement of catalyst with DNA.
:{|style="margin-left:100px" border="1"
|[[Image:Hi_speed.png|Simulation of high-speed|700px]]
|-
|-
|style="padding:10px"|Fig. 2.2 &nbsp;&nbsp;&nbsp;Image of each molecular motor’s instantaneous speed with time
|}
|}
<div align = "right" style="padding-right:200px">[[#TOP|↑]]</div>
 
<br><br>
<br><br>
<div align = "right" style="padding-right:20px">[[#TOP|↑Page Top]]</div>
<hr>
<hr>
=<font color="red">1.Rail-free</font>=
 
:'''Energy prodction for rail-free movement'''
=<font color="orange">3. Introduction of a photo-switchable DNA system for the directional control</font>=
:&nbsp;&nbsp;&nbsp;&nbsp;In order to realize rail-free movement, we looked at the function of catalyst. Platinum or catalase catalysts decompose H<small>2</small>O<small>2</small> and emit H<small>2</small>O and O<small>2</small> bubbles. Since the driving force created by divergence of bubbles, and rocket proceeds by dissociation of oxygen, rail does not require.
:<html><body><font size="5">We developed a photo-switchable DNA system for the directional control with a photoresponsive DNA.</font></body></html><br>
:&nbsp;&nbsp;&nbsp;&nbsp;In this section, we show 3 results that involved in  energy production for rail-free movement.
{|style="margin-left:35px"
:{|style="background-color:#FA8072;height:140px"
|
|style="width:190px"|<div align="center"><HTML><A href=#DNA_hybridization_in_solution_of_H2O2 title=DNA hybrudization><IMG width="190px"
&nbsp;&nbsp;&nbsp;&nbsp;The photo-switchable DNA system consists of an azobenzene-based photoresponsive DNA. The structure of the photoresponsive DNA is changed by UV light irradiation, then the photoresponsive DNA duplex is dissociated into DNA single strands. By the dissociation of DNA, catalytic engines are dissociated from the body of Biomolecular Rocket. As a result, the directional change of the force generated by O<sub>2</sub> bubble is caused, and the direction of the Biomolecular Rocket is changed. Here, we developed and investigated the photo-switchable DNA system by the following experiments and simulations.
src="http://openwetware.org/images/f/f1/DNA_hybrudization.jpg"></A></HTML></div>
{|width="620px" border="3"
|style="width:190px;"|<div align="center"><HTML><A href=#Observation_of_platinum_hemisphere title="Platinum hemisphere"><IMG width="190px" src="http://openwetware.org/images/4/4c/Platinum_hemisphere.jpg"></A></HTML></div>
|<html><body><ol>
|style="width:190px"|<div align="center"><HTML><A href=#Energy_production_by_using_catalase title="Catalase"><IMG width="190px" src="http://openwetware.org/images/5/5a/Catalase_image.jpg"></A></HTML></div>
<li>Design of a photo-switchable DNA system for the directional control
<li>Investigation of the dissociation rate of the photo-switchable DNA duplex by UV light irradiation experiments
<li>Investigation of the directional control of Biomolecular Rocket with the photo-switchable DNA system by numerical simulations
</ol></body></html>
|}
|}
<div align = "right" style="padding-right:200px">[[#TOP|↑]]</div>
==DNA hybridization in solution of H<small>2</small>O<small>2</small>==
:{|
|-
|width="700px"|[[Image:BIOMODTNJEPR 04.JPG|thumb|center|image of DNA hybridization|700px]]
|
|
&nbsp;&nbsp;&nbsp;&nbsp;We used PAGE electrophoresis to ascertain '''the stability of DNA duplex in thin H₂O₂ solution 1%~5%'''.<br><br>
<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/8/8a/DC.jpg" border=0 width=300 height=230></a></td></body></html>
&nbsp;&nbsp;&nbsp;PAGE electrophoresis shows the difference of molecular weight that comes from denaturetion or hybridization in the form of bands.
:>>see [[Biomod/2012/Titech/Nano-Jugglers/Methods#DNA_hybridization_in_solution_of_H2O2|Method]]
|}
|}
:&nbsp;&nbsp;&nbsp;&nbsp;This image shows the observation results of DNA hybridization in solution of Hydrogen peroxide for 90minutes.From the picture, the hybridized DNA band appear in lane 1,2,3&8. In lane 4,5,6&7 appears single strand band. Lane1&8 are the same, lane 2 & 3 are added hydrogen peroxide solution (1% and 5% for 1h)for 90 minutes. In Lane 5&7 shows the observation results of single strand DNA (ssDNA) in solution of Hydrogen peroxide. In lane 4&6 are the control band of ssDNA.<br><br>
==3.1. Design of photoresponsive DNA==
:&nbsp;&nbsp;&nbsp;&nbsp;Upper white dotted line represents the same position of Lane 1&8 in that they are the same sample. Comparing between 4.5.6&7, these 4 lines appear lower than the white line, and 4-5and 6-7 are few differences. If hydrogen peroxide affects ssDNA, destroy, tear up or denature, line 5 and 7 will appear in the lower position or becomes unclear. Judging from appearances, differences between positive and negative control ware few.Comparing 1,2,3 and 8,these lines are completely appear in the white bar.Differences between these lines are only concentration of hydrogen peroxide. So, we conclude that there is no influence of hydrogen peroxide for DNA hybridizations however DNA is exposed to hydrogen peroxide within 90minutes.So, we could determine that there is no effect of hydrogen peroxide for dsDNA as well as ssDNA.
<div align = "right" style="padding-right:200px">[[#TOP|↑]]</div>
==Observation of platinum hemisphere behavior in solution of H<small>2</small>O<small>2</small>==
:{|
:{|
|-
|-
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/4/4c/Platinum_hemisphere.jpg" border=0 width=300 height=240></a></td></body></html>
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/4/45/Photo_design.jpg" border=0 width=210 height=210></a></td></body></html>
|
|<html><body><font size="5">We designed photoresponsive DNA strands for a photo-switchable DNA system to achieve the directional control of Biomolecular Rocket.</font></body></html><br>
:>>see [[Biomod/2012/Titech/Nano-Jugglers/Methods#Observation_of_platinum_hemisphere_behavior_in_solution_of_H2O2|Method]]
>>see more [[Biomod/2012/Titech/Nano-Jugglers/Methods/Design_of_photoresponsive_DNA|methods]]<br><br>
&nbsp;&nbsp;&nbsp;&nbsp;We designed a photoresponsive DNA strand based on DNA sequence S<sup>*</sup>; four azobenzene molecules were introduced into S<sup>*</sup>. Figure 3.1.1 shows that absorbance spectra of DNA strands (A) photoresponsive DNA sequence S<sup>*</sup>, (B) DNA sequence S, and (A+B) the duplex of them at a room temperature. The absorbance of (A+B) around 260nm was less than those of (A) and (B). This indicated that the hybridization of (A) with (B) was stable at a room temperature.
|}
|}
==Energy production by using catalase==
{|style="margin-left:200px" width="500px" border = "1"
:{|
|-
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/5/5a/Catalase_image.jpg" border=0 width=300 height=240></a></td></body></html>
|
|
:>>see [[Biomod/2012/Titech/Nano-Jugglers/Methods#Energy_production_by_using_catalase|Method]]
[[Image:TNJ-figure3-azobenzene.png|Spectrum analysis|500px]]
|}
<div align = "right" style="padding-right:200px">[[#TOP|↑]]</div>
<br><br>
<hr>
=<font color="blue">2.High-speed</font>=
:'''High-speed movement of Biomolecular Rocket'''
:&nbsp;&nbsp;&nbsp;&nbsp;Catalytic engine produced sufficient energy to move quickly, but further accelerate the Biomolecular Rocket, we conjugated numerous platinum catalytic engines to a rocket body by taking advantage of DNA hybridization and denaturation. Emission of the bubbles depends on the surface area of catalyst. If the catalytic surface area is expanded, it is obvious that our rocket will be able to emit more bubbles and speeding up.
:&nbsp;&nbsp;&nbsp;&nbsp;In this section, we show 2 results that involved in  high-speed movement of biomolecular Rocket.
:{|style="background-color:#6495ED;height:140px"
|style="width:190px"|<div align="center"><HTML><A href=#Analysis_of_platinum_by_High-speed_camera title="High-speed camera"><IMG width="190px" src="http://openwetware.org/images/6/60/High-speed_camera.jpg"></A></HTML></div>
|style="width:190px"|<div align="center"><HTML><A href=#Simulation_for_speeding-up_of_Biomolecular_Rocket title="Speeding up simulation"><IMG width="190px" src="http://openwetware.org/images/f/f0/Simulation_speed.jpg"></A></HTML></div>
|}
<div align = "right" style="padding-right:200px">[[#TOP|]]</div>
==Analysis of platinum by High-speed camera==
:{|
|-
|-
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/6/60/High-speed_camera.jpg" border=0 width=300 height=240></a></td></body></html>
|style="padding:10px"|Fig.3.1&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Absorbance spectra of DNA strands (A) photoresponsive DNA sequence S*, (B) DNA sequence S, and (A+B) the duplex of them at a room temperature.
|
:>>see [[Biomod/2012/Titech/Nano-Jugglers/Methods#Analysis_of_platinum_by_High-speed_camera|Method]]
|}
|}
:<HTML><iframe width="420" height="315" src="http://www.youtube.com/embed/7pBw4FWEt3I" frameborder="0" allowfullscreen></iframe></HTML><br>
:<HTML><iframe width="420" height="315" src="http://www.youtube.com/embed/E1rtI0mS5Zs" frameborder="0" allowfullscreen></iframe></HTML><br>
<div align = "right" style="padding-right:200px">[[#TOP|↑]]</div>
==Simulation for speeding-up of Biomolecular Rocket==
::<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/f/f0/Simulation_speed.jpg" border=0 width=300 height=240></a></td></body></html>
<div align = "right" style="padding-right:200px">[[#TOP|↑]]</div>
<br><br>
<hr>
=<font color="yellow">3.Control</font>=
:'''Directional control of Biomolecular Rocket'''
:&nbsp;&nbsp;&nbsp;&nbsp;Direction of the rail-free movement of our rocket can be controlled, since we designed the photoresponsive DNA. Photoresponsive DNA structure is changed by UV light irradiation, then dissociation of double strand DNA will happen.
:&nbsp;&nbsp;&nbsp;&nbsp;In this section, we show 3 results that involved in directional control of biomolecular Rocket.
:{|style="background-color:#FFD700;height:140px"
|style="width:190px"|<div align="center"><HTML><A href=#Design_of_azobenzene-modified_DNA title="DNA design of azobenzene"><IMG width="190px" src="http://openwetware.org/images/a/ac/Azobenzene_modified_DNA.jpg"></A></HTML></div>
|style="width:190px"|<div align="center"><HTML><A href=#Dissociation_of_azobenzene-modified_DNA_by_UV-light_irradiation title="Azobenzene"><IMG width="190px" src="http://openwetware.org/images/9/97/Dissociation_of_DNA.jpg"></A></HTML></div>
|style="width:190px"|<div align="center"><HTML><A href=#Simulation_for_directional_control_of_Biomolecular_Rocket title="Directional control simulation"><IMG width="190px" src="http://openwetware.org/images/5/5a/Simulation_directional_control.jpg"></A></HTML></div>
|}
<div align = "right" style="padding-right:200px">[[#TOP|↑]]</div>


==Design of azobenzene-modified DNA==
==3.2. Achievement of the photo-switchable DNA system==
:{|
:{|
|-
|-
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/a/ac/Azobenzene_modified_DNA.jpg" border=0 width=300 height=240></a></td></body></html>
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/f/f3/Azobenzene_image_dissociation.jpg" border=0 width=240 height=180></a></td></body></html>
|
|
&nbsp;&nbsp;&nbsp;&nbsp;We designed photo-responsive  DNA strand in order to control the direction of Biomolecular Rocket.
<html><body><font size="5">We have succeeded in development of a photo-switchable DNA system.</font></body></html><br>
:>>see [[Biomod/2012/Titech/Nano-Jugglers/Methods#Design_of_azobenzene-modified_DNA|Method]]
>>see more [[Biomod/2012/Titech/Nano-Jugglers/Methods/Dissociation_of_photoresponsive_DNA|methods]]<br><br>
&nbsp;&nbsp;&nbsp;&nbsp;We introduced the photo-switching DNA system into Biomolecular Rocket in order to control its moving direction.
|}
|}
<div align = "right" style="padding-right:200px">[[#TOP|↑]]</div>
:&nbsp;&nbsp;&nbsp;To investigate the relationship between the strength of UV light and the irradiation time for dissociation of the photoresponsive DNA and determine the valid time for UV light irradiation, we examined two types of strength of UV light.
&nbsp;&nbsp;&nbsp;&nbsp;We incorporated 4 azobenzene units into "seqA_thiol" DNA strand so that we can quickly dissociated DNA duplex.
:&nbsp;&nbsp;&nbsp;Figure 3.2.1a represents the absorbance spectra in the condition of UV-light irradiation with the strength of 30 mW/cm<sup><small>2</small></sup>. The absorbance of the DNA duplex (A+B) at the wavelength of 260 nm gradually increased from 0 minutes to 5 minutes (Fig. 3.2.1b). This result means that the DNA duplex (A+B) was dissociated after 5 minutes irradiation of UV light. Moreover, the absorbance of the DNA duplex (A+B) at 330 nm decreased from 0 minutes to 5 minutes (Fig. 3.2.1b). This means that the trans-formed azobenzene changed its form to cis-formation. Therefore, we conclude that the dissociation of the photoresponsive DNA can be achieved by 5 minutes irradiation of UV-light (30 mW/cm<sup><small>2</small></sup>).
&nbsp;&nbsp;&nbsp;&nbsp;seqA_azo4_5thiol [ThiSS]AATXACXCCXAGXCC (X=Azobenzene)
{|style="margin-left:35px" width="800px" border = "1"
==Dissociation of azobenzene-modified DNA by UV-light irradiation==
|&nbsp;&nbsp;&nbsp;&nbsp;'''a'''<br>[[Image:Azo figure3.jpg|Spectrum analysis|400px]]
:{|
|&nbsp;&nbsp;&nbsp;&nbsp;'''b'''<br>[[Image:TNJ-figure4-azobenzene.png|Wave length around 260 nm and 330 nm|400px]]
|-
|-
|<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/9/97/Dissociation_of_DNA.jpg" border=0 width=300 height=240></a></td></body></html>
|style="padding:10px" colspan="2"|Fig. 3.2.1. (a)&nbsp;&nbsp;&nbsp;&nbsp;Absorbance spectra of photoresponsive DNA duplex (A+B) in condition of UV light irradiation (30 mW/cm<sup><small>2</small></sup>). (b) Time course of the absorbance change during UV light irradiation.
|
&nbsp;&nbsp;&nbsp;&nbsp;Azobenzene including DNA can easily dissociate its duplex by irradiating UV-light. We put this switching system in the rocket body and enabled its control.
 
:>>see [[Biomod/2012/Titech/Nano-Jugglers/Methods#Dissociation_of_azobenzene-modified_DNA_by_UV-light_irradiation|Method]]
|}
|}
:{|border = "1"
<br>
:&nbsp;&nbsp;&nbsp;&nbsp;Similarly, we studied the dissociation rate of photoresponsive DNA under the condition of UV light irradiation with the strength of 180 mW/cm<sup><small>2</small></sup> (Fig. 3.2.2a). Figure 3.2.2b represents that the DNA duplex (A+B) was gradually dissociated from 0 seconds to 50 seconds because the maximum absorbance at 260 nm increased. Figure 3.2.2c shows that the trans-formed azobenzene changed to the cis-fomed one by the UV irradiation because the absorbance at 330 nm decreased from 0 seconds to 50 seconds. Figure 3.2.2d shows that the cis-formed azobenzene increased because the absorbance at 480 nm increased from 0 seconds to 50 seconds. In summary, the photo-switchable DNA system worked by 50-second irradiation of UV-light (180 mW/cm<sup><small>2</small></sup>). From these results, we conclude that the dissociation of photoresponsive DNA by UV-light irradiation was achived.
{|style="margin-left:35px" width="800px" border = "1"
|&nbsp;&nbsp;&nbsp;&nbsp;'''a'''<br>[[Image:TNJ-figure5-azobenzene.png|Spectrum analysis|400px]]
|&nbsp;&nbsp;&nbsp;&nbsp;'''b'''<br>[[Image:TNJ-figure6-azobenzene.png|Wave lengte around 260 nm|400px]]
|-
|-
|No.
|&nbsp;&nbsp;&nbsp;&nbsp;'''c'''<br>[[Image:TNJ-figure8-azobemzene.png|Wave lengte around 330 nm|400px]]
|Solusion(time irradiating UV-light(minute))
|&nbsp;&nbsp;&nbsp;&nbsp;'''d'''<br>[[Image:TNJ-figure7-azobenzene.png|Wave lengte around 480 nm|400px]]
|light wavelength(nm)
|absorbance
|-
|-
|1
|style="padding:10px" colspan="2"|Fig. 3.2.2&nbsp;&nbsp;&nbsp;&nbsp;Spectrum analysis of photoresponsive DNA duplex(A+B) in condition of UV-light(180 mW/cm<sup><small>2</small></sup>) irradiation
|A(0)
|}
|265
 
|0.224
==3.3. Directional control of the Biomolecular Rocket by the photo-switchable DNA system==
:&nbsp;&nbsp;&nbsp;&nbsp;<html><body><font size="5">By numerical simulations, we found that the Biomolecular Rocket changes its direction by the UV light irradiation even though the Biomolecular Rocket is affected by the viscous resistance force and Brownian dynamics of water.</font></body></html><br>
:>>see more [[Biomod/2012/Titech/Nano-Jugglers/Simulation|Simulation Models]]
:&nbsp;&nbsp;&nbsp;&nbsp;Figure 3.3 shows the trajectories of the the Biomolecular Rockets of 10 μm in diameter by the numerical simulation. Each trajectory shows the movement of the Biomolecular Rocket that detaches catalytic engines after the irradiation of UV light when 10 seconds, 15 seconds, 20 seconds, and 25 seconds passed. This simulation results suggested that the Biomolecular Rocket can change its direction immediately after all catalytic engines are dissociated even though the viscous resistance and Brownian movement prevented the controlled movement of the Biomolecular Rocket. From these results, we conclude that the Biomolecular Rocket changes its direction by UV light irradiation.
{|style="margin-left:170px" width="600px" border="1"
|[[Image:ControlResult画像.png|Control simulation|600px]]
|-
|-
|2
|style="padding:10px"|Fig. 3.3 Trajectories of Biomolecular Rockets of 10 μm in diameter by the numerical simulation. Each trajectory shows the movement of Biomolecular Rocket that detaches catalytic engines after the irradiation of UV light when 10 seconds, 15 seconds, 20 seconds, and 25 seconds passed.
|B(0)
|261
|0.153
|-
|3
|A+B(0)
|263
|0.138
|-
|colspan="3"|<span style="color:red"><center>an average absorbance of number 1 and 2</center></span>
|(0.188.5)
|-
|4
|A+B(1)
|262
|0.179
|-
|5
|A+B(5)
|262
|0.179
|-
|6
|A+B(30)
|262
|0.178
|}
|}
:A: Azobanzen including ssDNA
 
:B: Normal ssDNA which is complimentary DNA with A
<div align = "right" style="padding-right:20px">[[#TOP|↑Page Top]]</div>
:A+B: this solution include A and B
:The above table shows the relationship between the time of irradiating UV-light and the absorbance of photoresponsive DNA. The detail is on the page 'Azobenzen Protocol'.
==Discussion==
:A relational expression about absorbance can be expressed as follows.
: [[Image:Math.png|200px]]
:(Abs: absorbance,  ε: the absorption coefficient, c: strength, d: length of a visual leg )
:Solution A+B include 5µM strength of DNA i and DNA ii, so when no DNA formed duplex in the solution A+B, we can simply calculate its absorbance. The value is 188.5(calculated an average absorbance of No.1 and 2). Compared with this value and the absorbance of No.3, the former is 37% larger than the latter. In brief, We thought this difference comes from that DNA formed duplex in the solution of No.3 and interactions between base pairs decrease the UV absorbance relative to single strands.
:In this point, we believed that the complementary photo-responsive DNAs can form duplex.
:Look at the absorbance of No.3 and No.4~6, as the solution A+B was irradiated longer time, its absorbance suddenly move upwards from a border between No.3 and No.4. We thought this difference comes from that DNA duplex completely dissociated in the solution of No.4~6 due to more than 1 minute irradiation of the UV-light.
:In this point, we believed that the photo-responsive DNA duplex which we designed can be dissociated with irradiation of the UV-light.
<div align = "right" style="padding-right:200px">[[#TOP|↑]]</div>
==Simulation for directional control of Biomolecular Rocket==
::<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/5/5a/Simulation_directional_control.jpg" border=0 width=300 height=240></a></td></body></html>
<div align = "right" style="padding-right:200px">[[#TOP|]]</div>

Latest revision as of 00:04, 28 October 2012


<html> <head> <style type="text/css"> /* ====================

  主に全体に関わるCSS

   ==================== */ body.mediawiki {

                       font-size: 14px;

background-image:url(http://openwetware.org/images/2/2d/TNJback.png); background-repeat: repeat; font-family: Calibri, Verdana, helvetica, sans-serif; }

               h1 {
                       padding: 0px 20px 5px 20px;
                       font-size: 34px;
                       line-height: 40px;
                       font-weight: bold;
               }
               h2 {
                       padding: 20px 20px 5px 20px;
                       font-size: 25px;
                       color: #000000;
                       text-decoration: none;
                       font-weight: bold; 
              }
               h2 a {
                       color: #eb8300;
               }
               h3 {
                       padding: 20px 20px 5px 20px;
                       font-size: 20px;
                       color: #000;
                       font-decoration: none;
                       font-weight: bold;
               }
               h1.firstHeading {

display: none;

               }

p { text-align: justify; } a:link { color: #00a5ea; text-decoration: none } a:visited { color:#00a5ea; text-decoration: none } a:hover {

                       color: #eb8300;

text-decoration: none } a:active { color:#f29400; text-decoration: none } #content{ margin: 0px 0 0px 0; align: center; padding: 12px 12px 12px 12px; width: 946px; background-color: #ffff; border: 0; } #bodyContent{ width: 970px; margin: 150px auto 0 auto; align: center; background-color: #ffffff; } #globalWrapper{ margin: 20px 0 0 0; width:994px; background-color: #ffffff; margin-left: auto; margin-right: auto } #biomodlink{ position:absolute;top:0px; width:970px;height:20px; background-color: #ffffff; margin:3px auto 3px auto }


/* ====================

  メニューの画像を変更できる部分
  ==================== */

#header {

                       margin: 0 auto 0 auto;
                       position:absolute;
                       top:28px; width:968px;height:189px;

background-color: #FFFFFF; background-repeat: no-repeat;

                       background-image: url(http://openwetware.org/images/7/74/Title-LOGO6.jpg); 

} /* ====================

  以下、特殊なclassに適用される
  ==================== */

#navigation { position:absolute;

                       top:120px; width:970px; height:92px;
                       background-repeat: no-repeat;

color: #0000FF; }

/* ====================

  ここからプルダウン周辺のデザイン
  ==================== */
  1. menu * {

margin: 0; padding: 0; }

  1. menu {
       position:absolute;

font-family: calibri, verdana, sans-serif;

       font-color: #000000;

background-color: transparent; float:left; display: block; }

  1. menu ul {
       position:relative;

float: left; text-align:center; list-style: none; }

  1. menu li {

background-color:yellow;

       position:relative;

float:left;

       width: 136px;

font-size: 23px;

       font-weight: bold;

border:ridge 0px #FFFFFF; }

  1. menu li.ach {

background-color:yellow;

       position:relative;

float:left;

       width: 162px;

font-size: 23px;

       font-weight: bold;

border:ridge 0px #FFFFFF; }

  1. menu li.sup {

background-color:yellow;

       position:relative;

float:left;

       width: 109px;

font-size: 17px;

       font-weight: bold;

border:ridge 0px #FFFFFF; }

  1. menu li.none {

background-color:yellow;

       position:relative;

float:left;

       width: 152px;

font-size: 17px;

       font-weight: bold;

border:ridge 0px #FFFFFF; }

  1. menu a {

color: #000000; display:block; text-decoration: none; }

  1. menu a:hover {

background-color:gold; }

  1. column-one { display:none; width:0px;}

.container{background-color: #ffffff; margin-top:0px} .OWWNBcpCurrentDateFilled {display: none;}

  1. footer{position: center; width: 994px}

@media screen {

   body { background: #F5F5F5 0 0 no-repeat;  /* changed default background */ }

} </style> </head> <BODY> <div id="biomodlink"> <<a href="http://openwetware.org/wiki/Biomod">BIOMOD</a>|<a href="http://openwetware.org/wiki/Biomod/2012">2012</a>|Titech Nano-Jugglers </div> <div id="header"> <div id="navigation"> <div id="menu"> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers"><br>Home<br><br></a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers/Team/Students"><br>Team<br><br></a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers/Project"><br>Project<br><br></a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers/Results">Results<br>&<br>Methods</a></font></li> <li class="ach"><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers/Achievements"><br>Achievements<br><br></a> <li class="sup"><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers/Protocols"><br>Suppl. Info.<br><br></a></li> <li class="none"><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers/Acknowledgement"><br>Acknowledgements<br><br></a></li> </ul> </div> </div> </div> </BODY> </html>

Results

<html><body><A href=#0._Construction_of_Biomolecular_Rocket title="Body"><img src="http://openwetware.org/images/b/b5/BM.jpg" border=0 width=310 height=240></a></body></html>

    Construction of Biomolecular Rocket

  • We constructed Biomolecular Rocket composed of a micrometer-sized body and many catalytic engines. The catalytic engines were conjugated to the body using DNA-bead linkers in a spatially selective manner.

        Shown in detail below

<html><body><A href=#1._Power_supply_for_the_rail-free_movement_of_the_Biomolecular_Rocket title="Rail-free"><img src="http://openwetware.org/images/7/7f/Rail-free%E3%80%80movement_kinesin.jpg" border=0 width=310 height=220></a></body></html>
Power supply for the rail-free movement of the Biomolecular Rocket
<html><body><A href=#2._Realization_of_the_high-speed_movement_of_the_Biomolecular_Rocket title="High-speed"><img src="http://openwetware.org/images/8/89/High-speed_movement.jpg" border=0 width=310 height=220></a></body></html>
Realization of high-speed movement of the Biomolecular Rocket
<html><body><A href=#3._Introduction_of_a_photo-switchable_DNA_system_for_the_directional_control title="Control"><img src="http://openwetware.org/images/d/dd/Control_image.jpg" border=0 width=310 height=220></a></body></html>
Introduction of a photo-switchable DNA system for the directional control
  • We realized the rail-free movement by power generation with catalytic reactions of platinum and catalase.




      Shown in detail below

  • We realized the high-speed movement by power generation with catalytic reactions of platinum and catalase, and analyzed the speed.
  • We carried out numerical simulations of the high-speed movement of the Biomolecular Rockets.

      Shown in detail below

  • We developed a photo-switchable DNA system for controlling of the Bimolecular Rocket using UV light irradiation.
  • We investigated directional control of the Biomolecular Rocket in the simulations.

      Shown in detail below




0. Construction of Biomolecular Rocket

<html><body><font size="5">We constructed Biomolecular Rocket with a microbead, catalysts, and designed DNAs.</font></body></html>

    Biomolecular Rocket is composed of a micrometer-sized body and many catalytic engines. The body consists of a microbead with a diameter of 10 μm, and catalytic engines consist of platinum nanoparticles or catalase molecules. The catalytic engines are conjugated to the body using a DNA-based linker in a spatially selective manner.
    We constructed the Biomolecular Rocket through the following four steps.

<html><body><ol>

<li>The microbead body was selectively coated by vapor deposition of metals (Au and Cr).<br> <li>We designed DNA sequences for spatially-selective hybridization of catalytic engines.<br> <li>The DNA molecules were conjugated to a designated metal surface of the microbead body.<br> <li>Catalyst engines were attached to the microbead body with selective hybridization of DNAs we designed.</ol></body></html>

    >>see more methods

<html><body><td align="center"><img src="http://openwetware.org/images/4/4d/Charts.jpg" border=0 width=200 height=440></a></td></body></html>

0.1. Selective coating of the body

<html><body><font size="5">We succeeded in selective coating of a micrometer-sized bead by vapor deposition of Au and Cr.</font></body></html>

>>see more methods

<html><body><td align="center"><img src="http://openwetware.org/images/a/a5/Vapor_deposition.jpg" border=0 width=330 height=110></a></td></body></html>
    Figure 0.1a, b and c are microscope images of 40 μm microbeads. Figure 0.1a shows microbeads before vapor deposition of metals. Figure 0.1b shows microbeads after vapor deposition of Au (gold) on the microbeads. Figure 0.1c shows microbeads after additional vapor deposition of Cr (chromium) on the Au-deposited microbeads. The microbeads had three types of surface areas because the angular alignment of the beads was changed when Cr was deposited on the Au-deposited microbeads.
    Similarly, Figure 0.1e, f and g are microscope images of 10 μm microbeads. Figure 0.1e shows microbeads before vapor deposition of metals. Figure 0.1f shows microbeads after vapor deposition of Au on the microbeads. Figure 0.1g shows microbeads after additional vapor deposition of Cr on the Au-deposited microbeads. The 10 μm microbeads probably had three types of surface areas. From these results, we conclude that selective coating of microbeads for the Biomolecular Rocket was achieved.
  <html><body><nobr>40 μm silica beads</nobr></body></html>     a
40 μm silica beads
    b
After first deposition
    c
After second deposition
  <html><body><nobr>10 μm polystyrene beads</nobr></body></html>       d
10 μm polystyrene beads
    e
After first deposition
    f
After second deposition
  <html><body><nobr>Image of micro-beads</nobr></body></html> <html><body><img src="http://openwetware.org/images/d/d5/Polystyrene.jpg" border=0 width=240 height=180></body></html> <html><body><img src="http://openwetware.org/images/4/41/After_first_deposition.jpg" border=0 width=240 height=180></body></html> <html><body><img src="http://openwetware.org/images/3/30/After_second_deposition.jpg" border=0 width=240 height=180></body></html>
    Fig. 0.1 Selective coating of micro-beads by vapor deposition.

0.2. Design of linker DNA strands

<html><body><font size="5">We designed DNA sequences for the linkers to attach catalytic engines to the microbead body.</font></body></html>
>>see more methods
    We designed two kinds of DNA sequences with different stability. One is DNA sequence L. This sequence forms a very stable duplex with its complementary sequence L* at a room temperature. Another is DNA sequence S. The duplex of DNA sequence S and S* has less stability than DNA sequence L and L* but is stable at a room temperature.
  DNA sequence L

  <html><body><nobr>5’-CGTCTATTGCTTGTCACTTCCCC-3'&nbsp;&nbsp;</nobr></body></html>

  DNA sequence S

  <html><body><nobr>5’-AATACCCAGCC-3’&nbsp;&nbsp;</nobr></body></html>

  DNA sequence L*

  <html><body><nobr>5'-GGGGAAGTGACAAGCAATAGACG-3'&nbsp;&nbsp;</nobr></body></html>

  DNA sequence S*

  <html><body><nobr>5’-GGCTGGGTATT-3'&nbsp;&nbsp;</nobr></body></html>

    Figure 0.2a and 0.2b show calculated melting profiles of duplexes L-L* and S-S*, respectively. Calculated melting temperatures of these duplexes were higher than a room temperature.
  a
DNA Tm
  b
Photoresponsive DNA Tm
Fig. 0.2. (a) The melting profile of duplex L-L*. (b) The melting profile of duplex S-S*. RT and Tm indicate a room temperature (24°C) and a melting temperature, respectively. We calculated the melting profiles using NUPACK software.

0.3. Selective DNA conjugation to the microbead body of Biomolecular Rocket

0.3.1. Selective conjugation of DNA to polystyrene surface area


<html><body><td align="center"><img src="http://openwetware.org/images/f/f5/Polystyrene_EDAC.jpg" border=0 width=300 height=240></a></td></body></html> <html><body><font size="5">We succeeded in selective DNA conjugation to the polystyrene surface area of the microbead body.</font></body></html>

>>see more methods

    We conjugated amino-modified DNA sequence L* to the calboxylated polystyrene surface area of the microbead body with amide binding. To investigate the selective conjugation of L*, we hybridized a fluorophore-modified DNA sequence L with L* on the body and observed the DNA-conjugated microbead bodies.

    Figure 0.3.1a, b, and c are bright-field microscope images of selectively-coated microbead bodies (10 μm in diameter). Figure 0.3.1a', b', and c' are fluorescence microscope images of the selectively-coated microbead bodies. Figure 0.3.1a and a' shows selectively DNA-L*-conjugated microbeads with fluorophore-modified DNA L. Fluorescence of L was observed only where the polystyrene surface was exposed after the vapor deposition of metal. Figure 0.3.1b and b' shows selectively DNA-L*-conjugated microbeads without fluorophore-modified DNA L, and no fluorescence was observed. Figure 0.3.1c and c' shows non-DNA-conjugated microbeads with fluorophore-modified DNA L, and no fluorescence was observed. From these results, we conclude that selective conjugation of DNA L* to polystyrene surface area of the microbead bodies was achieved.
  <html><body><nobr>Bright-field microscope images</nobr></body></html>       a    
DNA conjugated beads and FAM
    b    
DNA conjugated beads
    c    
Beads and FAM
  <html><body><nobr>Fluorescence microscope images</nobr></body></html>       a'    
DNA conjugated beads and FAM
    b'    
DNA conjugated beads
    c'    
Beads and FAM
  <html><body><nobr>Experimental conditions<nobr></body></html>   <html><body><img src="http://openwetware.org/images/d/d3/EDACBEADS1.JPG" border=0 width=220 height=120></a></body></html> <html><body><img src="http://openwetware.org/images/3/38/EDACBEADS2.JPG" border=0 width=220 height=120></a></body></html> <html><body><img src="http://openwetware.org/images/2/23/EDACBEADS3.JPG" border=0 width=220 height=120></a></body></html>
Fig. 0.3.1 Microscope images of the microbead bodies of Biomolecular Rocket. (a) and (a') Selectively DNA-conjugated microbeads with complementary fluorophore-modified DNA. (b) and (b') Selectively DNA-conjugated microbeads without complementary fluorophore-modified DNA. (c) and (c') non-DNA-conjugated microbeads with complementary fluorophore-modified DNA.

0.3.2. Selective conjugation of DNA to metal surface area


<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/8/87/Metal_SAM.jpg" border=0 width=300 height=240></a></td></body></html> <html><body><font size="5">We succeeded in selective DNA conjugation to the Au surface area of the microbead body.</font></body></html>

>>see more methods

    We conjugated thiol-modified DNA sequence S* to the Au surface area of the microbead body with Au-thiol bonding. To confirm the selective conjugation of S* to an Au surface, we observed an Au-deposited cover glass after DNA conjugation instead of selectively Au-coated microbeads after DNA conjugation. We investigated the wetting properties of the Au surface before and after DNA conjugation because the wetting investigation showed the selective conjugation of DNA more clearly than the fluorescence observation like Fig. 0.3.1.

    Figure 0.3.2a shows the Au glass plate with a non-DNA spot (1), a non-thiol-modified DNA spot (2), and a thiol-modified DNA spot (3). Only at the spot (3), residual water was observed. The water remained by the wetting property of the spot (3); the higher wetting property of spot (3) than those of spots (1) and (2) was expected to be caused by the Au surface with thiol-modified DNA conjugation. Therefore, we conclude that selective conjugation of thiol-modified DNA to the Au surface area of the microbead body was also achieved.
    a    
Au plate
    b    
condition
    c
<html><body><img src="http://openwetware.org/images/1/1a/Auplate1.jpg" border=0 width=800 height=150></a></body></html>
Fig. 0.3.2. (a) An Au glass plate with a non-DNA spot (1), a non-thiol-modified DNA spot (2), and a thiol-modified DNA spot (3).
(b) A layout drawing of the spots (1)-(3).
(c) Experimental condition for the spots (1)-(3).

0.4. Catalyst attachment with DNA hybridization

<html><body><td align="center"><img src="http://openwetware.org/images/1/19/Conjugation_catalyst.jpg" border=0 width=300 height=230></a></td></body></html> <html><body><font size="5">Catalyst engines are attached to the microbead body of Biomolecular Rocket with DNA hybridization reactions between L and L<sup>*</sup>, and S and S<sup>*</sup>.</font></body></html>

>>see more methods

    From the results of sections 0.1 and 0.3, a selectively DNA-conjugated microbead body of Biomolecular Rocket is constructed. In addition, we prepared catalytic engines with DNA-tag sequences (L and S) that are complementary to the DNA sequences (L* and S*) on the body. Therefore, by mixing the DNA-tagged catalytic engines and selectively DNA-conjugated body, Biomolecular Rocket would be constructed in a self-assembled manner. Experiments are currently in progress.




<html><body><font color="red">1. Power supply for the rail-free movement of the Biomolecular Rocket</font></body></html>

<html><body><font size="5">We achieved the power supply for the rail-free movement of the Biomolecular Rocket.</font></body></html>
    We utilized H2O2 for fuel and catalysts of H2O2 for catalytic engines to realize the rail-free movement of the Biomolecular Rocket. Catalysts such as platinum and catalase catalyze the decomposition of H2O2 into H2O and O2; emitted bubbles of O2 launch Biomolecular Rocket.

    Here, we investigated the following points to realize the power supply for the rail-free movement of the Biomolecular Rocket.

<html><body><ol>

<li>We found that catalase molecules as catalytic engines could emit sufficient amount of bubbles for the rail-free movement. <li>We found that platinum particles as a catalytic engines could emit sufficient amount of bubbles for rail-free movement. <li>We found that the H<sub>2</sub>O<sub>2</sub> did not affect the stability of DNA linkers for attaching catalytic engines to the body in the H<sub>2</sub>O<sub>2</sub> solution. </ol></body></html>

<html><body><td align="center"><img src="http://openwetware.org/images/b/b3/WikiRFBM.jpg" border=0 width=240 height=240></a></td></body></html>

1.1. Power supply for rail-free movement by using catalase catalytic engine

<html><body><font size="5">We succeeded in the rail-free movement by O<sub>2</sub> bubble emission with catalase.</font></body></html>
    We utilized the catalase for catalytic engines, which catalyzes the decomposition of H2O2 into H2O and O2. Here, we conjugated the catalase to the polystyrene area of a microbead with a hemispherical Au surface and a hemispherical polystyrene surface (Fig. 1.1).
>>see more methods

    Movie 1.1 shows the rail-free movement of a 10 μm microbead with a hemispherical Au surface and a hemispherical polystyrene surface by O2 bubble emission with catalase. The 10 μm beads without catalase did not move at all (Movie 1.2). Thus, we conclude that we succeeded in the rail-free movement by O2 bubble emission with catalase.
<html><body><img src="http://openwetware.org/images/1/1b/Crf.jpg" border=0 width=420 height=315></body></html>
Fig. 1.1  Image of a microbead with a hemispherical Au surface and a hemispherical polystyrene surface in 3% H2O2 solution.
<html><iframe width="420" height="315" src="http://www.youtube.com/embed/Ie2dUHcwZN0" frameborder="0" allowfullscreen></iframe></html>
Movie. 1.1   The real-time video of the moving 10 μm bead with a catalase-conjugated hemisphere area in 3% H2O2 solution.

1.2. Power supply for rail-free movement by using platinum catalytic engine

<html><body><font size="5">We achieved bubble emissions with platinum micro-particles in solution of H<sub>2</sub>O<sub>2</sub>.</font></body></html>
    We provided 1 μm platinum particles, and Cr coating to create platinum hemispherical area. Then added 3% H2O2 solution and observed their movement.
>>see more methods

    Movie 1.2 reveals the catalytic reaction of 3% H2O2 and 1 μm beads that have platinum hemispherical area. We can recognize that bubbles are emitted in H2O2 solution. These bubbles are emitted from 1 μm beads that have platinum hemispherical area by decomposing H2O2. From this result, we conclude that power supply for rail-free movement by using platinum catalytic engine was achieved.
<html><body><img src="http://openwetware.org/images/8/89/Simple_beads.jpg" border=0 width=420 height=315></a></body></html>
Fig. 1.2 Image of a microbead with a hemispherical Cr surface and a hemispherical platinum surface in 3% H2O2 solution.

<html><iframe width="420" height="300" src="http://www.youtube.com/embed/gPNaMMd3NP4" frameborder="0" allowfullscreen></iframe></html>

Movie. 1.2     Image of the catalytic reaction of 3% H2O2 and 1 μm beads that have platinum hemispherical area.

1.3. DNA hybridization in solution of H2O2

<html><body><font size="5">We revealed that diluted H<sub>2</sub>O<sub>2</sub> solutions did not affect DNA hybridization and a H<sub>2</sub>O<sub>2</sub> solution was suitable for a fuel for the Biomolecular Rocket. </font></body></html>
>>see more methods

   We confirmed that DNA duplexes were stably formed in diluted H2O2 solutions by the native polyacrylamide gel electrophoresis (PAGE). Figure 1.3 shows the gel image of the PAGE. As shown in the lanes 1-3, a double-stranded DNA was formed in 1% and 5% H2O2 solutions.
Electrophoresis
Fig. 1.3    A gel image of a native PAGE of DNA in H2O2 solutions. Lanes 1-3, 8: a double stranded DNA (D+R) in diluted H2O2 solutions eith concentrations 0% (lanes 1 and 8), 1% (lane 2), and 5% (lane 3). In lanes 4-7, single stranded DNAs in 0% and 5% H2O2 solutions were shown. DNA sequences R and D are shown at the upper right of the image.




2. Realization of the high-speed movement of the Biomolecular Rocket

<html><body><font size="5">We confirmed the high-speed movement of the Biomorecular Rocket by bubble emission.</font></body></html>

    Catalytic engines emit large amount of bubbles, and thus, supply powerful driving force to the Biomolecular Rocket. By the analyses of the movement of platinum particles and numerical simulations, we found that the speed of the Biomolcular Rocket was faster than that of kinesin. We carried out the experiments and simulations as follows.
<html><body><ol>

<li>Observations of the movement of platinum particles using a high-speed camera and analyses of the speed <li>Numerical simulations of the movement of the Biomolecular Rocket</ol></body></html>

<html><body><img src="http://openwetware.org/images/2/26/Hst.jpg" width=300 height=230></body></html>

2.1. Power supply for the high-speed movement with platinum catalytic engines

<html><body><font size="5">We succeeded in high speed movement with platinum catalytic engines.</font></body></html>
>>see more methods and full length movie

    Movie 2.1.1a shows the movement of 0.15-0.40 μm platinum particles in 3% H2O2 solution. Movie 2.1.1b is the movement of platinum particles observed by a high-speed camera (the upper left of the movie) and its analyzed results (the right of the movie). The analyzed results show the values of acceleration (top), velocity (the second from the top), coordinate x (third), and coordinate y (bottom) of platinum movement. From the results, we found the relationships between the growth of bubble radius and the speed of platinum. Using the relationships and the kinetic parameters, we did numerical simulations of the movement of the Biomolecular Rocket (see Section 2.2).
    Figure. 2.1.2 shows the graph of the mean square displacement of the platinum particle. We can calculate mean speed of platinum particle by making a quadratic curve fitting and calculating square root of coefficient of the curve. We calculated that the value of quadratic coefficient was 115.5 mm2/s2, and the average speed was calculated as 10.7 mm/s. Assuming that kinesin moves at 1μm/s, Platinum particles in H2O2 solution can moved at about 10,000 time’s faster speed than kinesin.
   a
<html><iframe width="440" height="330" src="http://www.youtube.com/embed/7pBw4FWEt3I" frameborder="0" allowfullscreen></iframe></html>
   b
<html><iframe width="440" height="330" src="http://www.youtube.com/embed/R4RsXKiknIs" frameborder="0" allowfullscreen></iframe></html>
Movie. 2.1.1    Analyses of the speed of platinum in solution of H2O2.

(a)  Platinum movement in solution of H2O2          (b)  Analyses of the speed of plutinum by High-speed camera

  Fig. 2.1.2 The mean square displacement of a platinum particle.

2.2. Numerical estimation of the speed of the Biomolecular Rocket

<html><body><font size="5">The numerical simulation revealed that the Biomolecular Rocket can move ten times faster than kinesin.</font></body></html>
>>see more simulation models
    The simulation also demonstrated that the Biomolecular Rocket with many platinum catalysts on the body can move twice faster than a microbead with a hemispherical platinum surface moves because of the difference in the catalytic surface areas between them (Fig. 2.2).
    Figure 2.2 shows instantaneous speed at each time steps of kinesin motor, 10 μm beads with a hemispherical platinum surface (catalytic motor without DNA), and 10 μm of the Biomolecular Rocket. We take the average of 100 time step's instantaneous speed of each molecular motor and make a comparison among them.
    As a result, the average speed of the Biomolecular Rocket is calculated as 11.2 μm/s, and the average speed of catalytic motor without DNA is 6.8 μm/s. We assumed that Kinesin moves straightforward at 1.0 μm/s all the time, Kinesin's average speed is calculated as 1.0 μm/s.
    Therefore, we estimate that the Biomolecular Rocket moves faster than kinesin. Moreover, the Biomolecular Rocket can get more speed by surface enlargement of catalyst with DNA.
Simulation of high-speed
Fig. 2.2    Image of each molecular motor’s instantaneous speed with time




3. Introduction of a photo-switchable DNA system for the directional control

<html><body><font size="5">We developed a photo-switchable DNA system for the directional control with a photoresponsive DNA.</font></body></html>

    The photo-switchable DNA system consists of an azobenzene-based photoresponsive DNA. The structure of the photoresponsive DNA is changed by UV light irradiation, then the photoresponsive DNA duplex is dissociated into DNA single strands. By the dissociation of DNA, catalytic engines are dissociated from the body of Biomolecular Rocket. As a result, the directional change of the force generated by O2 bubble is caused, and the direction of the Biomolecular Rocket is changed. Here, we developed and investigated the photo-switchable DNA system by the following experiments and simulations.

<html><body><ol>

<li>Design of a photo-switchable DNA system for the directional control <li>Investigation of the dissociation rate of the photo-switchable DNA duplex by UV light irradiation experiments <li>Investigation of the directional control of Biomolecular Rocket with the photo-switchable DNA system by numerical simulations </ol></body></html>

<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/8/8a/DC.jpg" border=0 width=300 height=230></a></td></body></html>

3.1. Design of photoresponsive DNA

<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/4/45/Photo_design.jpg" border=0 width=210 height=210></a></td></body></html> <html><body><font size="5">We designed photoresponsive DNA strands for a photo-switchable DNA system to achieve the directional control of Biomolecular Rocket.</font></body></html>

>>see more methods

    We designed a photoresponsive DNA strand based on DNA sequence S*; four azobenzene molecules were introduced into S*. Figure 3.1.1 shows that absorbance spectra of DNA strands (A) photoresponsive DNA sequence S*, (B) DNA sequence S, and (A+B) the duplex of them at a room temperature. The absorbance of (A+B) around 260nm was less than those of (A) and (B). This indicated that the hybridization of (A) with (B) was stable at a room temperature.

Spectrum analysis

Fig.3.1     Absorbance spectra of DNA strands (A) photoresponsive DNA sequence S*, (B) DNA sequence S, and (A+B) the duplex of them at a room temperature.

3.2. Achievement of the photo-switchable DNA system

<html><body><td align="center" width="150px"><img src="http://openwetware.org/images/f/f3/Azobenzene_image_dissociation.jpg" border=0 width=240 height=180></a></td></body></html>

<html><body><font size="5">We have succeeded in development of a photo-switchable DNA system.</font></body></html>
>>see more methods

    We introduced the photo-switching DNA system into Biomolecular Rocket in order to control its moving direction.

   To investigate the relationship between the strength of UV light and the irradiation time for dissociation of the photoresponsive DNA and determine the valid time for UV light irradiation, we examined two types of strength of UV light.
   Figure 3.2.1a represents the absorbance spectra in the condition of UV-light irradiation with the strength of 30 mW/cm2. The absorbance of the DNA duplex (A+B) at the wavelength of 260 nm gradually increased from 0 minutes to 5 minutes (Fig. 3.2.1b). This result means that the DNA duplex (A+B) was dissociated after 5 minutes irradiation of UV light. Moreover, the absorbance of the DNA duplex (A+B) at 330 nm decreased from 0 minutes to 5 minutes (Fig. 3.2.1b). This means that the trans-formed azobenzene changed its form to cis-formation. Therefore, we conclude that the dissociation of the photoresponsive DNA can be achieved by 5 minutes irradiation of UV-light (30 mW/cm2).
    a
Spectrum analysis
    b
Wave length around 260 nm and 330 nm
Fig. 3.2.1. (a)    Absorbance spectra of photoresponsive DNA duplex (A+B) in condition of UV light irradiation (30 mW/cm2). (b) Time course of the absorbance change during UV light irradiation.


    Similarly, we studied the dissociation rate of photoresponsive DNA under the condition of UV light irradiation with the strength of 180 mW/cm2 (Fig. 3.2.2a). Figure 3.2.2b represents that the DNA duplex (A+B) was gradually dissociated from 0 seconds to 50 seconds because the maximum absorbance at 260 nm increased. Figure 3.2.2c shows that the trans-formed azobenzene changed to the cis-fomed one by the UV irradiation because the absorbance at 330 nm decreased from 0 seconds to 50 seconds. Figure 3.2.2d shows that the cis-formed azobenzene increased because the absorbance at 480 nm increased from 0 seconds to 50 seconds. In summary, the photo-switchable DNA system worked by 50-second irradiation of UV-light (180 mW/cm2). From these results, we conclude that the dissociation of photoresponsive DNA by UV-light irradiation was achived.
    a
Spectrum analysis
    b
Wave lengte around 260 nm
    c
Wave lengte around 330 nm
    d
Wave lengte around 480 nm
Fig. 3.2.2    Spectrum analysis of photoresponsive DNA duplex(A+B) in condition of UV-light(180 mW/cm2) irradiation

3.3. Directional control of the Biomolecular Rocket by the photo-switchable DNA system

    <html><body><font size="5">By numerical simulations, we found that the Biomolecular Rocket changes its direction by the UV light irradiation even though the Biomolecular Rocket is affected by the viscous resistance force and Brownian dynamics of water.</font></body></html>
>>see more Simulation Models
    Figure 3.3 shows the trajectories of the the Biomolecular Rockets of 10 μm in diameter by the numerical simulation. Each trajectory shows the movement of the Biomolecular Rocket that detaches catalytic engines after the irradiation of UV light when 10 seconds, 15 seconds, 20 seconds, and 25 seconds passed. This simulation results suggested that the Biomolecular Rocket can change its direction immediately after all catalytic engines are dissociated even though the viscous resistance and Brownian movement prevented the controlled movement of the Biomolecular Rocket. From these results, we conclude that the Biomolecular Rocket changes its direction by UV light irradiation.
Control simulation
Fig. 3.3 Trajectories of Biomolecular Rockets of 10 μm in diameter by the numerical simulation. Each trajectory shows the movement of Biomolecular Rocket that detaches catalytic engines after the irradiation of UV light when 10 seconds, 15 seconds, 20 seconds, and 25 seconds passed.