Biomod/2012/UCSD/tRiton Nano Architects/Experiment: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 36: Line 36:
Free energy explanation
Free energy explanation


dG Aptamer - Complement system
ΔG Aptamer - Complement system
dG Aptamer – Lysozyme system


Theoretically, the system ought to work  
Variant 1: -9 kcal/mole
 
Varient 2: -8.76 kcal/mole
 
 
ΔG Aptamer – Lysozyme system
 
Theoretically, the system ought to work


==Fitting Parts Together==
==Fitting Parts Together==

Revision as of 22:29, 27 October 2012

<html> <head> 

 <style>
  1. column-one { display:none; width:0px;}

.container{background-color: #ececec; margin-top:50px} .OWWNBcpCurrentDateFilled {display: none;}

  1. content {width: 0px; margin: 0 auto auto 0; padding: 1em 1em 1em 1em; align: center;}
  2. column-content {width: 0px; float: left; margin: 0 0 0 0;padding: 0;}

.firstHeading {display:none; width:0px;}

  1. globalWrapper{width:1280px; margin:auto}

body {background: #ececec!important;}

  1. column-one {display:none; width:0px;background-color: #ececec;}
  2. content{border:none;margin: 0 0 0 0; padding: 1em 1em 1em 1em; position: center; width: 800px;background-color: #ececec; }

.container{ width: 800px; margin: auto; background-color: #ececec; text-align:justify; font-family: helvetica, arial, sans-serif; color:#ececec; margin-top:25px; }

  1. bodyContent{ width: 1267px; align: center; background-color: #ececec;}
  2. column-content{width: 1280px;background-color: #ececec;}

.firstHeading { display:none;width:0px;background-color: #ececec;}

  1. header{position: center; width: 800px;background-color: #ececec;}
  2. footer{position: center; width:1280px;}
 </style>

</head> </html>

<html><center><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects'><img src=http://openwetware.org/images/a/a0/Trna_logo_with_title5.png width=1118px></a></center></html> <html><center><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects'><img src=http://openwetware.org/images/e/e5/Menuspacer2.png width=8px></a></center></html>

<html> <head> 

 <style type="text/css">

@import url(http://fonts.googleapis.com/css?family=Open+Sans:600);

/* Menu CSS */

  1. cssmenu, #cssmenu > ul{

background: url(http://openwetware.org/images/a/a0/Highlight-bg.png) repeat; padding-bottom: 3px; font-family: 'Open Sans', sans-serif; font-weight: 600;

}

  1. cssmenu:before, #cssmenu:after, #cssmenu > ul:before, #cssmenu > ul:after {

content: ''; display: table;

}


  1. cssmenu:after, #cssmenu > ul:after {

clear: both;

}

  1. cssmenu {

zoom:1;

}

  1. cssmenu > ul{

background: url(http://openwetware.org/images/0/04/Menu-bg2.png) repeat; margin: 0; padding: 0; position: relative;

}

  1. cssmenu > ul li{

margin: 0; padding: 0; list-style: none;

}

  1. cssmenu > ul > li{

float: left; position: relative;

}

  1. cssmenu > ul > li > a{

padding: 23px 26px; display: block; color: white; font-size: 13px; text-decoration: none; text-transform: uppercase; text-shadow: 0 -1px 0 #9e3825; text-shadow: 0 -1px 0 rgba(10, 12, 42, .70); line-height: 18px;

}


  1. cssmenu > ul > li:hover > a{

background: url(http://openwetware.org/images/4/48/Hover5.png) repeat; text-shadow: 0 -1px 0 #97321f; text-shadow: 0 -1px 0 rgba(32, 56, 112, .64);

}

  1. cssmenu > ul > li > a > span{

line-height: 18px;

}

  1. cssmenu > ul > li.active > a, #cssmenu > ul > li > a:active{

background: url(http://openwetware.org/images/b/b1/Active3.png) repeat;

}


/* Childs */

  1. cssmenu > ul ul{

opacity: 0; visibility: hidden; position: absolute; top: 120px; background: url(http://openwetware.org/images/a/a0/Highlight-bg.png) repeat; margin: 0; padding: 0; z-index: -1; -webkit-transition: all .35s .2s ease-in-out; -moz-transition: all .35s .2s ease-in-out; -ms-transition: all .35s .2s ease-in-out; transition: all .35s .2s ease-in-out;

}

  1. cssmenu > ul li:hover ul{

opacity: 1; visibility: visible; margin: 0; color: #000; z-index: 2; top:64px; left: 0;

}

  1. cssmenu > ul ul:before{

content: ''; position: absolute; top: -10px; width: 100%; height: 20px; background: transparent;

}


  1. cssmenu > ul ul li{

list-style: none; padding: 0; margin: 0; width: 100%;

}

  1. cssmenu > ul ul li a{

padding: 18px 26px; display: block; color: #393939; font-size: 13px; text-decoration: none; text-transform: uppercase; width: 150px; border-left: 4px solid transparent; -webkit-transition: all .35s ease-in-out; -moz-transition: all .35s ease-in-out; -ms-transition: all .35s ease-in-out; transition: all .35s ease-in-out; text-shadow: 0 1px 0 white;

}

  1. cssmenu > ul ul li a:hover{

border-left: 4px solid #0f2858; background: url(http://openwetware.org/images/a/a0/Highlight-bg.png) repeat; color: #20295C; text-shadow: 0 1px 0 black;

}

  1. cssmenu > ul ul li a:active{

background: url(http://openwetware.org/images/0/04/Menu-bg2.png) repeat;

} 

 </style type="text/css">

<div id='cssmenu'> <ul> 

  <li class='active has-sub '><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects'><span>Home</span></a>
     <ul>
        <li><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects#Abstract:_Fluorescent_DNA_Aptamer_for_lysozyme_detection'><span>Abstract</span></a></li>
        <li><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects#Video'><span>Video</span></a></li>
     </ul>
  </li>
  <li class='has-sub '><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects/Project_introduction'><span>Project Introduction</span></a>
     <ul>
        <li><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects/Project_introduction#Concepts'><span>Concepts</span></a></li>
     </ul>
  </li>
  <li class='has-sub '><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects/Experiment'><span>Experiment</span></a>
     <ul>
        <li><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects/Experiment#Methods'><span>Methods</span></a></li>
     </ul>
  </li>
  <li class='has-sub '><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects/Resources'><span>Supplementary Resources</span></a>
     <ul>
        <li><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects/Brainstorm#DNA_architecture_log'><span>DNA Architecture Log</span></a></li>
        <li><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects/Brainstorm#Project_Ideas'><span>Project Ideas</span></a></li>
        <li><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects/Literature'><span>Literature</span></a></li>
     </ul>
  </li>
  <li><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects/Team'><span>Team</span></a></li>

</ul> </div>

</head> </html>

<html><center><a href='http://openwetware.org/wiki/Biomod/2012/UCSD/tRiton_Nano_Architects'><img src=http://openwetware.org/images/a/ac/School.png width=1126px></a></center></html>

Methods

Oligo Sequences

The following oligo sequence is the aptamer of choice for lysozyme as it has a binding affinity of kd = 2.8 ± 0.3 nM as determined by fluorescence anisotropy [1]. According to previous research [2], a binding affinity in the order of nanomolar is sufficient for protein targets.

Aptamer Sequence: 5' – GCA GCT AAG CAG GCG GCT CAC AAA ACC ATT CGC ATG CGG C – 3'

Secondary Structure of the ssDNA Aptamer with flanking primers

This figure is adapted from Lammertyn’s “Selection and Characterization of DNA Aptamers for Egg White Lysozyme.” The figure shows the start site and end site of the aptamer from 5’ to 3’ respectively.

Aptamer 3’-end is alkyl-thiol modified and 5’-end of complement is modified with Cy5. Both are purchased from Integrated DNA Technologies, Inc.

Sequences

Aptamer flanked by primers with added Poly-A (n=10) tail:

5’-AGC AGC ACA GAG GTC AGA TG GCAGCTAAGCAGGCGGCTCACAAAACCATTCGCATGCGGC CCT ATG CGT GCT ACC GTG AAA AAA AAA AAA – thiol -3'

Aptamer Complement Variant 1:

5' –(Cy5)— TTTCACAATAGCACAATATAGGC - 3'

Aptamer Complement Variant 2:

5' –(Cy5)— TTTCACAATAGCAAAATATAGGC - 3'

Design Principles

Free energy explanation

ΔG Aptamer - Complement system

Variant 1: -9 kcal/mole

Varient 2: -8.76 kcal/mole


ΔG Aptamer – Lysozyme system

Theoretically, the system ought to work

Fitting Parts Together

We follow adapted protocols from Mirkin’s “Nano-flares for mRNA Regulation and Detection.”

Gold nanoparticle + Aptamer

From literature [3] and [4], a suitable method is adopted to maximize DNA loading onto gold nanoparticles using salting techniques, sonication and temperature. Essentially, it involves adding thiol-modified aptamers to a solution of gold nanoparticles (13 ± 1 nm), waiting for 2 hours, followed by addition of sodium dodecylsulphate (SDS), phosphate buffer (pH=7.4), and sodium chloride. This is further followed by slow incremental addition of sodium chloride until a final concentration of 0.3M.


Gold nanoparticle + Aptamer + Complement

The aptamers now bound on gold nanoparticles are hybridized to their short complements by adding 106 times more complementary strands than aptamers by concentration. For hybridization to occur, the strands are heated to 70˚C and slowly cooled down to room temperature over four hours and stored at 4 ˚C.

Fluorescence Spectroscopy: To verify function and measure selectivity of aptamer

When the lysozyme detector is in a fully hybridized state, the fluorophore is close to the quencher and will result in a low fluorescence signal. In the presence of the target, the lysozyme protein, the short complementary strand with the fluorophore will be released into solution. This will result in increased fluorescence and indicate the binding of aptamer to target.

Protocol:

a. Add aptamer-complement duplex (1 nM) to phosphate buffered saline solution (pH 7.4).

b. Measure fluorescence in the absence of target. Use excitation wavelength of 648 nm and except emission wavelength at 668 nm for Cy5 fluorophore.

c. Measure fluorescence in the presence of target. Excitation and emission wavelengths, same as above.

d. Compute fold-change in fluorescence.


Figure X. Fluorescence spectra of Lysozyme Detector before and after addition of lysozyme.

Similar measurements can be performed for the same detector for the following cases

a. Detector + lysozyme

b. Detector + lysozyme + proteins of similar structure

A high fluorescence for lysozyme only, will demonstrate the aptamer’s high specificity.

References

1. Tran, Dinh T., et al. "Selection and characterization of DNA aptamers for egg white lysozyme." Molecules 15.3 (2010): 1127-1140.

2. Nutiu, Razvan, and Yingfu Li. "Structure-switching signaling aptamers." Journal of the American Chemical Society 125.16 (2003): 4771-4778.

3. Prigodich, Andrew E., et al. "Nano-flares for mRNA regulation and detection." ACS nano 3.8 (2009): 2147-2152.

4. Mirkin, Chad A. (Wilmette, IL, US), Lytton-jean, Abigail K. R. (Chicago, IL, US), Hurst, Sarah J. (Evanston, IL, US) 2010 "Maximizing Oligonucleotide Loading on Gold Nanoparticle". United States 20100099858 http://www.freepatentsonline.com/y2010/0099858.html


Retrieved from "https://openwetware.org/mediawiki/index.php?title=Biomod/2012/UCSD/tRiton_Nano_Architects/Experiment&oldid=648287"