Biomod/2013/Aarhus/Materials And Methods/Peptide lock

<html> <style> /* ul.menu li.</html>Materials_And_Methods/Peptide_Lock<html> a {

 color: cyan;

}

/

toc {

display: none; }

mytoc {

background: none; width: 200px; }

.toc { border: 0px solid; }

toc ul ul,.toc ul ul {

margin: 0 0 0 1em; }

table.toc { background-color: #f0f4f4; }

mytoc a,#mytoc a:visited {

font-size: normal; color: #222222; }

mytoc a:hover {

font-color: #009ee0; /* text-decoration: underline; */ }

wiki-toc {

width: 200px; margin-top: 6px; float: left; }

wiki-body {

margin-left: 200px; padding-left: 12px; padding-right: 35px; }

toc #toctitle,.toc #toctitle,#toc .toctitle,.toc .toctitle {

text-align: left; }

toc h2,.toc h2 {

font-weight: normal; font-size: 17px; }

/*

wiki-contents A {

color: #00aeef; }

wiki-contents A:HOVER {

color: #00aeef; }

/

toctitle span {

display: none; }

/*

wiki-body p,#wiki-body li,#wiki-body dd,div.thumbcaption {

font-size: medium; }

/

/* required to avoid jumping */

tocScrolWrapper {

/* left: 450px; */ position: absolute; /* margin-left: 35px; width: 280px; */ }

tocScrol {

position: absolute; top: 0; /* just used to show how to include the margin in the effect */ /*margin-top: 20px; */ /* border-top: 1px solid purple; */ /*padding-top: 19px;*/ }

tocScrol.fixed {

position: fixed; top: 0; }

editPageTxt {

text-align: left; padding-left: 15px; }

editPageTxt P {

clear: both; }

toPageTop {

float: left; position: relative; top: 18px; left: 13px; color: #d13f31; } </style>

$('#mytoc').find("#toc").attr("id", ""); parentTable.closest('table').remove(); });

$(document).ready( function() { var top = $('#tocScrol').offset().top - parseFloat($('#tocScrol').css('marginTop').replace( /auto/, 0)); var nav = $('#tocScrol'); var max = $('#indexing').offset().top - nav.height();

$(window).scroll(function(event) { // what the y position of the scroll is var y = $(this).scrollTop();

if (y > top) { // && signs are html decoded thus this construction if (y >= max) { nav.removeClass('fixed'); nav.css({ position : 'absolute', top : max - top }); } else { nav.addClass('fixed'); nav.removeAttr('style'); } } else { nav.removeClass('fixed'); nav.removeAttr('style'); } }); }); </script> <html> <html> <div id="wiki-contents"> <div id="tocScrolWrapper"> <div id="tocScrol"> <div id="wiki-toc"> <a id="toPageTop" href="#">▲</a> <table id="mytoc" class="toc" summary="Contents"> </table> <div id="editPageTxt"> <p> [<a href="http://openwetware.org/index.php?title=Biomod/2013/Aarhus/</html>Materials_And_Methods/Peptide_Lock<html>&action=edit">edit this page</a>] </p> </div> </div> </div> </div> <div id="wiki-body"> </html>

Peptide Lock

Generel

All chemicals were purchased from Sigma-Aldrich and used without further purification unless otherwise stated. Solvents were employed as HPLC-grade and anhydrous solvents were purchased in Sure/Seal bottles with inert atmosphere or dried using a MBRAUN MB SPS-800 Solvent Purification System. Reactions were carried out under argon atmosphere and with flame dried glassware unless otherwise stated. Organic reactions were monitored by thin-layer chromatography (TLC) whenever possible and flash chromatography (FC) was carried out on Silica gel 60 (230-400 mesh). The names of synthesised molecules were generated using ChemBioDraw Ultra v. 12.0.2. NMR spectra were recorded on a Bruker Avance III HD system connected to a 400 MHz Bruker Ascend magnet. Chemical shifts are reported in ppm and corrected according to the solvent residual peak.[1] Coupling constants (J ) are reported in Hz. Mass spectra of small molecules were obtained on a Bruker Maxis Impact (ESI-TOF) using a Dionex Ultimate 3000 RS (HPLC) as interface. Melting points were obtained on a B?ÜCHI Melting Point B-540 system and reported uncorrected. H₂O used for DNA experiments was purified on a Milli-Q Biocel system by Millipore, and abbreviated as MQ. DNA oligonucleotides were synthesised in house on a BioAutomation MerMade-12 automated oligonucleotide synthesiser using reagents, standard and special phosphoramidites, and preloaded 1000 Å CPG columns purchased from BioAutomation in Texas. Synthesized oligonucleotides were cleaved from the solid-support either using 33% ammonium hydroxide solution or AMA. BioAutomation MerMade-12 automated oligonucleotide synthesiser was washed with dry solvents (DCM, DMSO, MeCN) before each experiment in order to keep the pipes clean and dry. All DNA concentrations were determined using a Nanodrop ND-1000 spectrophotometer. Mass spectra of oligonucleotides were either obtained on a Bruker Daltonics Auto ex Speed MALDI-TOF MS spectrometer using AnchorChip target plates, or on a Shimadzu LCMS-2020EV connected to a Shimadzu Prominence RP-UPLC system equipped with a Phenomenex Gemini 3u C18, 100 mm x 4.6 mm column and running a gradient of MeOH in 1,1,1,3,3,3-hexa uoroisopropanol/triethylamine buffer (HFIP, 100 mM / TEA, 8 mM). All LCMS measurements are performed in linear negative mode. The matrix used for MALDI-TOF MS was 90 % 3-hydroxypicolinic acid (50 mg/mL) in H₂O/MeCN 1:1 and 10 % diammonium citrate (50 mg/mL) in H₂O. All MALDI experiments were performed in linear negative mode unless otherwise stated. Dynamic light scattering experiments was performed on a Zetasizer Nanoseries ZS, using the provided Zetasizer software and cuvettes. For gel analysis, a Typhoon Trio with the provided Variable Mode Imager software was used.

Solid Phase Peptide Synthesis

Synthesis of (S)-2-((tert-butoxycarbonyl)amino)-5-methoxy-5-oxopentanoic acid [2]

(S)-2-((tert-butoxycarbonyl)amino)-5-methoxy-5-oxopentanoic acid (0.100 mg, 0.6 mmol, 1 eq.) was dissolved in 1,4-dioxane (10 mL) in a roundbottomed flask with magnetic stirrer. Hereafter DIPEA (0.2 mL, 1.2 mmol, 2 eq.) was added and after 5 min Fmoc-OSu (0.330 mg, 1.0 mmol, 1.7 eq.) was added. The resulting mixture was stirred for 5 hours until the reaction was judged finished by TLC. The mixture was concentrated in vacuo and stored overnight. The mixture was redissolved in DCM (5 mL) and purified by FC (SiO2, DCM/EtOAc 1:1 v/v, 15 mL fractions). The product was isolated as a yellow solid (1) (0.206 mg, 0.5 mmol, 87 %).

¹H NMR (400 MHz, CDCl₃): δ 9.41 (br. s, OH), 7.77 (d, J= 7.4, 2H), 7.60-7.59 (m, 2H), 7.41 (t, J= 7.3, 2H), 7.32 (t, J= 7.3, 2H), 5.62 (d, J= 7.7, NH), 4.54- 4.42 (m, 3H), 4.23 (t, J= 6.7, 1H), 3.69 (s, 3H), 2.54-2.41 (m, 2H), 2.32-2.29 (m, 1H), 2.10-2.05 (m, 1H); ¹³C NMR (100 MHz, CDCl₃): δ 176.3, 173.9, 156.6, 143.9, 141.6, 128.1, 127.4, 125.4, 120.3, 67.6, 53.6, 52.3, 47.4, 30.4, 27.5; HRMS (ES) m/z: [M+Na]⁺ calcd. for C₂₁H₂₁NO₆, 406.1261; found: 406.1265; MP 116.4 - 117.0 °C (DCM/EtOAc 1:1).

Synthesis of Peptides

4-pentynoyl-GPLGIAGE(OMe)G-ol

The peptide was synthesised on an ABI 433A automated peptide synthesiser employing the Fmoc/tBu strategy on a 0.1 mmol scale using a H-Gly-ol-2CT resin (0.50mmol/g). Deprotection was performed using 20% piperidene/DMF for 2x2 minutes. All positions was double coupled using 5 eq. Fmoc-Aa-OH, 4.9 eq. HCTU, 10 eq. N-methyl morpholine for 2x2 minutes, except for the alkyne which was introduced manually using 5 eq. pent-4-ynoic acid, 5.1 eq. DIC, 5 eq. Oxyma in DMF for 30 mins. Drydown of the sample was performed by washing with DMF (x3), DCM (3x) and Et2O (3x) followed by drying in vacuo. Cleavage was performed by subjecting the protected peptidyl-resin to a mixture of TFA/DCM/TIPS (48.75%/48.75%/2.5%, v/v, 5ml) for 30 mins. The filltrate was concentrated to 1ml and the peptide was precipitated with ice-cold TBME, centrifuged, decanted (3 times) and dissolved in 5 ml H₂O/MeCN 1:1 and lyophilized (crude yield; 83mg.). Next the crude peptide was dissolved in H2O/MeCN (95%/5%, 9ml) and purified employing a linear gradient of 5-50% MeCN (0.1% TFA), over 25 mins, at 5ml/min on a Jupiter C18 250x10mm, 300 Å, 5 μm column, yielding 35 mg of product displaying a purity of 98%.

MALDI-TOF MS:

m/z calcd. for C₃₉H₆₃N₉NaO₁₂ [M+Na]⁺, 872.45; found 872.75.

RP-HPLC: tR = 8.83 min. (Agilent Poroshell 120 EC-C18 (4.6 x 150 mm, 2.7 μm, 120 Å) 5-90 % MeCN over 15 min.)

4-pentynoyl-GPLGIAGQG-OH

The peptide was synthesized on a ABI 433A automated peptide synthesizer employing the Fmoc/tBu strategy on a 0.1 mmol scale using a H-Gly-2CT resin (0.70mmol/g). Deprotection was performed using 20% piperidene/DMF for 2x2 minutes. Couplings where conducted using 5 eq. Fmoc-Aa-OH, 5 eq. DIC, 5 eq. Oxyma Pure for 20 minutes. Drydown was performed by washing with DMF (x3), DCM (3x) and Ether (3x) followed by drying in vacuo. Cleavage was performed by subjecting the protected peptidyl-resin to a mixture of TFA/DCM/TIPS (48.75%/48.75%/2.5%, v/v, 5ml) for 30 mins. The filtrate was concentrated to 1ml and the peptide was precipitated with ice-cold TBME, centrifuged, decanted (3 times) and dissolved in 5 ml H₂O/MeCN. The crude peptide was purified employing a linear gradient of 5-50% MeCN (0.1% TFA), over 25 mins, at 5ml/min on a Jupiter C18 250x10mm, 300 Å, 5 μm column, yielding 29 mg of product displaying a purity of 98%.

MALDI-TOF MS:

m/z calcd. for C₃₈H₆₀N₁₀NaO₁₂ [M+Na]⁺ 871.43; found 872.10.

RP-HPLC: tR = 7.35 min. (Phenomenex Aeris peptide XB-C18, 4.6x150mm, 3.6μm, 100Å, 2ml/min, 5-90% MeCN over 15 mins).

Automated Oligonucleotide Synthesis

Peptide Coupling - peptide activation and DNA activation

For peptide coupling with phosphoramidite activated DNA, the peptide (5.5 mg) was dissolved in anhydrous DMSO (1 mL). For the peptide pre activation experiment, the peptide (5.1 mg, 6.5 μmol, 1 eq.) was dissolved in DMSO (1 mL) to which N,N-diisopropylchlorophosphoramidite in DCM (0.25 mL 35 mM, 7.8 μmol, 1.2 eq.) and DIPEA in DCM (0.25 mL 31 mM, 7.8 μmol, 1.2 eq.) was added. The automated oligonucleotide synthesiser was setup to the following sequence:

3'-AAGTGGCGTCTATATCCAGAAATCG-peptide

Mermade setup; phosphoramidite activated peptide The activated peptide (approx. 0.140 mL) (in 2 steps) was automatically added onto the column. Hereafter wash (1x), capping (1x), wash (1x), oxidize, wash (2x) detritylation (1x) steps were performed, likewise automatically. Mermade setup: phosphoramidite activated DNA For coupling of peptide with phosphoramidite activated DNA, DIPEA and phosphoramidite in DCM (approx. 0.375 mL each, added in 5 steps of 30 sec.), wash (3x), peptide (approx. 0.140 mL ) was added to the column, afterwards washing (2x), oxidise (1x), wash (2x) and detritylation (1x) finishing with a wash (1x).

DNA activated coupling and peptide activated coupling solid phase was incubated with NH₄OH (1 mL) for 2 hours at 65 °C. NH₄OH was removed in vacuo and the pellet was dissolved in MilliQ (0.5 mL), spun/vortexed 3 times and purified through 3k spinfiltration. MALDI-TOF and LCMS analysis was performed. The calculated mass is for the truncated DNA (AAGTGGCGTCTATATCCAGAAATCG).

MALDI-TOF MS m/z:

Mass calcd. for C₂₄₅H₃₀₇N₉₇O₁₄₆P₂₄ [M+H]⁺, 7691.00. Found 7692.51.

LCMS m/z:

Mass calcd. for C₂₄₅H₃₀₇N₉₇O₁₄₆P₂₄ [M+H]⁺, 7691.00. Found 7691.16.

DNA activated Peptide Coupling - click reaction with small organic molecule

Thesequence setup on the automated oligonucleotide was:

3'-AAGTGGCGTCTATATCCAGAAATCG-peptide-CGTACTATTCGACTCTCAAG-5'

For the click reaction two conditions were used. A solution of 13 mM 2- (2-(2-azidoethoxy)ethoxy)ethanol, 1.3 mM ascorbate, 290 μM TBTA and 18 μM CuSO₄\cdot5H₂O was prepared in a 1:1:0.6 tBuOH:MQ:DMSO and 1:0.3 MQ:DMSO mixture respectively. According to the runlog of the automated olignucleotide synthesiser 3 mL of the above mentioned mixtures was used. Due to the viscosity of DMSO a smooth flow could not be obtained, and only 1 mL of mixture was injection onto column according to visual approximations. After eventual peptide coupling and 3x washes, the previously mentioned mixtures for the click reaction were added in 15 steps over 2.5 hours. Then a deblock step initialised the synthesis of the remaining DNA strand.

Mermade Setup; For coupling of peptide with phosphoramidite activated DNA, DIPEA and phosphoramidite in DCM (approx. 0.375 mL each, added in 5 steps with 30 sec.), wash (3x), peptide (approx. 0.140 mL ) was added to the column, afterwards washing (2x), oxidise (1x), wash (2x) and detritylation (1x) finishing with a wash (1x). DNA activated coupling and peptide activated coupling CPG coloums was incubated with NH₄OH (1 mL) for 2 hours at 65 °C. NH₄OH was removed in vacuo and the pellet was dissolved in MQ (0.5 mL), spun/vortexed 3 times and purified through 3k spinfiltration.

Synthesis of DNA strands

Amine modified DNA strands

3' amine modified 20 mer: 3'- CGTACTATTCGACTCTCAAG-5'

5' amine modified 25 mer: 3'-AAGTGGCGTCTATATCCAGAAATCG-5'

a) 3' modified 20 mer, b) 5' modified 25 mer

5' amino modification was achieved by treatment by 5'MMT-amino-modified-11-CE-phosphoramidite as the final step of the . 3'amino modification was achieved by using 3'-amino-modifer C7 CPG 1000. Standard conditions of automated oligonucleotide synthesis was used. The product mixture was cleaved off solid support using NH₄OH at 65°C for 2 hours. 3' amino modified DNA strand was purified by top coloumn and precipicated in ethanol. 5' amino modified DNA strand was purified trough ethanol precipication. The supernatant of the probes were decanted off and the samples were lyophillized o.n. The resulting mixture was redissolved in 400 μL MQ.

MALDI-TOF MS: m/z:

20mer calcd. for C₂₀₁H₂₆₃N₇₁O₁₂₃P₂₀ [M+H]⁺; 6259.13. Found 6261.49.

25mer calcd. for C₂₅₃H₃₂₅N₉₈O₁₅₂P₂₅ [M+H]⁺; 7942.42. Found 7937.85.

Azide Modified DNA strands

To amine modified DNA strand (10 μL, 1 mM in MQ) was added MQ (40 mmL), NHS-azide (50 μLmmL, 50 mM in DMF), MeCN (50 mmL) and DIPEA (μL) and the reaction was incubated at rt. overnight. The DNA was precipicated in ethanol. The supernatant was decanted of and the resulting mixture was dried in vacuo prior to redissolvation in MQ (200 μL).

Maldi-TOF MS m/z:

25 mer. calcd. C₂₅₈H₃₃₂N₁₀₁O₁₅₃P₂₅ [M+H]⁺: 8066.47. Found: 8063.28.

Template DNA strand

Following sequence was setup on the automated oligonucleotide synthesizer:

3'-CTTGAGAGTCGAATAGTACGTTTTTTTTCGATTTCTGGATATAGACGCCACTT-5'

Standard conditions and reagents are used. The strand was purified on top coloum, precipicated in ethanol, lyophillized o.n. and redissolved in 100 μL MQ.

MALDI-TOF MS: m/z:

Mass calcd. for C₅₂₁H₆₅₈N₁₈₄O₃₂₅P₅₂ [M+H]⁺; 16308.70. Found 16314.55.

CuAAC peptide and azide modified DNA

For the experiment the final concentrations where as following: 1 nmol DNA-azide, 100 nmol pepide, 500 yM TBTA, 100 yM Cu, 2 mM ascorbate. 2 mM TBTA (2:1 tBuOH, DMSO), 10 mM peptide solution (MQ) 10 mM ascorbate (MQ) and 5 mM CuSO4 (MQ) were freshly prepared. The solvent mixture of the reaction is As Cu in solution and ascorbate in solution was mixed a yellow colour was observed due to the reduction of copper.

CuSO₄ (4μL, 2mM) was mixed with ascorbate (40 μL, 10 mM) and TBTA (50 μL, 2 mM) was after 5 min added. To this solution 25 mer DNA azide (1 nmol, 43 μL, 23.1 yM) and peptide (100 nmol, 10 μL, 10 mM) was added. Further DMSO (50 μL) and MQ for a total volume of 200 μL was added. The solution was incubated overnight at rt. The mixture was precipitated in ethanol, supernatant was decanted off and the resulting pellet was dried in vacuo before redissolvation in MQ (200μL). The results were analyzed on MALDI-TOF.

MALDI-TOF MS m/z:

Mass calcd. for C₂₉₆H₃₉₂N₁₁₁O₁₆₅P₂₅ [M+H]⁺: 8919.27. Found 8918.15.

Templated amide bond formation

The reaction conditions are based on literature [3]. EDC/Sulfo NHS; 60 nM template, 120 nM reagent, 20 mM EDC, 15 mM Sulfo-NHS, 0.1 M MES ph 6 buffer, 1 M NaCl. The total volume was 20μL.DM-TMM; 60 nM template, 120 nM reagent, 50 mM DM-TMM, 0.1 MOPS ph 7 buffer, 1 M NaCl. The total volume was 20μL. The reagents where mixed and incubated at rt. O.N. The resulting mixture was concentrated in vacuo, redissolved in MQ. Loading buffer (native, sucrose+orangeG. denaturating, urea+orangeG) was added in 1:1 ratio with reaction mixture. The mixture was loaded onto the respective gels.

References

H. A. Behanna et al. Coassembly of amphiphiles with opposite peptide polarities into nanofibers. J. Am. Chem. Soc. 127, 1193-1200 (2005). [1]
[Behanna]
Z. J. Gartner et al. Expanding the reaction scope
of dna-templated synthesis. Angew. Chem. Int. Ed, 41, 1796-1800 (2002). <1796::AID-ANIE1796>3.0.CO;2-Z
[Gartner]
H. E. Gottlieb et al. NMR Chemical Shifts of Common Laboratory Solvents as Trace Impurities. J. Org. Chem. 62 7512-7515 (1997). [1]
[Gottlieb]

indexing {

/* float: left; position: center; */ background-color: #222; border-top: 2px solid #d13f31; color: #006e9c; margin: 0px; padding: 0px 0px 10px 0px; width: 100%; text-align: center; }

.footer-section { padding: 10px; display: table-cell; text-align: left; }

.footer-section-title { font-size: 20px; }

footer-contents {

color: #006e9c; display: inline-table; }

.footer-section A { color: #006e9c; text-decoration: none; }

.footer-section A:HOVER { color: #00aeef; }

.footer-section ul { list-style-type: square; }

sitemapTitle {

margin-top: 20px; font-size: 24px; }

editFooter {

float: right; margin-top: -28px; margin-right: 5px; }

editFooter A {

color: #006e9c; text-decoration: none; }

.cf:before,.cf:after { content: " "; /* 1 */ display: table; /* 2 */ }

.cf:after { clear: both; }

bodyContent a[href^="mailto:"], .link-mailto {

   background: url() no-repeat scroll right center transparent;
   padding-right: 0px;
   color: #006e9c;

}

</style> </head> <body> <div id="indexing"> <div id="sitemap"> <p id="sitemapTitle">SITEMAP | BIOMOD 2013 NANO CREATORS | Aarhus University</p> <div id="footer-contents"> <div class="footer-section"> <p class="footer-section-title">INTRODUCTION</p> <ul> <li><a href="/wiki/Biomod/2013/Aarhus">Home, abstract, animation and video</a></li> <li><a href="/wiki/Biomod/2013/Aarhus/Introduction">Introduction</a></li </ul> </div> <div class="footer-section"> <p class="footer-section-title">RESULTS AND DISCUSSION</p> <ul> <li><a href="/wiki/Biomod/2013/Aarhus/Results_And_Discussion/Origami">Origami</a></li> <li><a href="/wiki/Biomod/2013/Aarhus/Results_And_Discussion/Peptide_lock">Peptide lock</a></li> <li><a href="/wiki/Biomod/2013/Aarhus/Results_And_Discussion/Chemical_Modification">Chemical modification</a></li> <li><a href="/wiki/Biomod/2013/Aarhus/Results_And_Discussion/sisiRNA">sisiRNA</a></li> <li><a href="/wiki/Biomod/2013/Aarhus/Results_And_Discussion/System_In_Action">System in action</a></li> </ul> </div> <div class="footer-section"> <p class="footer-section-title">MATERIALS AND METHODS</p> <ul> <li><a href="/wiki/Biomod/2013/Aarhus/Materials_And_Methods/Origami">Origami</a></li> <li><a href="/wiki/Biomod/2013/Aarhus/Materials_And_Methods/Peptide_lock">Peptide lock</a></li> <li><a href="/wiki/Biomod/2013/Aarhus/Materials_And_Methods/Chemical_Modification">Chemical modification</a></li> <li><a href="/wiki/Biomod/2013/Aarhus/Materials_And_Methods/sisiRNA">sisiRNA</a></li> <li><a href="/wiki/Biomod/2013/Aarhus/Materials_And_Methods/System_In_Action">System in action</a></li> <li><a href="/wiki/Biomod/2013/Aarhus/Materials_And_Methods/Methods">Methods</a></li> </ul> </div> <div class="footer-section"> <p class="footer-section-title">SUPPLEMENTARY</p> <ul> <li><a href="/wiki/Biomod/2013/Aarhus/Supplementary/Team_And_Acknowledgments">Team and acknowledgments</a></li> <li><a href="/wiki/Biomod/2013/Aarhus/Supplementary/Optimizations">Optimizations</a></li> <li><a href="/wiki/Biomod/2013/Aarhus/Supplementary/Supplementary_Data">Supplementary data</a></li>

                                               <li><a

href="/wiki/Biomod/2013/Aarhus/Supplementary/Supplementary_Informations">Supplementary informations</a> <li><a href="/wiki/Biomod/2013/Aarhus/Supplementary/References">References</a></li> </ul> </div> </div> <div> <p id="copyright">Copyright (C) 2013 | BIOMOD Team Nano Creators @ Aarhus University | Programming by: <a href="mailto:pvskaarup@gmail.com?Subject=BIOMOD 2013:">Peter Vium Skaarup</a>.</p> </div> </div>

<div> <img alt="Sigma - Aldrich" src="http://openwetware.org/images/3/39/Sigmaaldrich-logo%28transparant%29.png" width="300px" height="154px"> <img alt="VWR International" src="http://openwetware.org/images/2/28/Vwr_logo.png" width="300px" height="61px"> <img alt="Promega" src="http://openwetware.org/images/7/72/Promega.png" width="175px" height="105px" style="padding-right: 5px; padding-left: 5px;"> <img alt="kem-en-tec" src="http://openwetware.org/images/3/3a/Kementec.png" width="130px" height="129px"> <img alt="Centre For Dna Nanotechnology" src="http://openwetware.org/images/4/4f/CDNA_logo.png" width="420px" height="90px"> <img alt="Dansk Tennis Fond" src="http://openwetware.org/images/9/9a/Dansk_tennis.png" width="250px" height="53px"> </div> <div id="editFooter"> [<a href="http://openwetware.org/index.php?title=Template:Biomod/2013/Aarhus/Nano_Creators/footer&action=edit">edit sitemap</a>] </div> </div> </body> </html>