Biomod/2013/Sendai/design: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
(201 intermediate revisions by 3 users not shown)
Line 41: Line 41:


</header>  
</header>  
<p class="sukima"> Design
</p>
  <section id="tabs">
<article data-title="Egg-type initiator">
<h3 id="egg">Egg-type initiator</h3></br>
<a name="#egg"></a>


<img src="http://openwetware.org/images/6/64/Design-top-01.png" alt="example-tab2" border="0"></br>
<div id="ttop">
<div align="center">
<a href="#top" class="page_top" onfocus="this.blur();" onclick="scrollTo(0,0); return false;" title="Top"></a></div>
                    Fig.1 process of Egg-type initiator</div><br>
<br>


Egg-type initiator consists of two layers.<br>
<section role="main">
        <article>
        <h2>Design</h2>


<h4>The first layer: “alginate gel membrane”</h4>
<table id="toc" class="toc" summary="Contents"><tr><td><div id="toctitle"><h2>Contents</h2></div>
The alginate gel membrane has a solution phase inside them, and resembles artificial salmon caviars (JINKOH-IKURA in Japanese).<br><br>
<ul>
<li class="toclevel-1"><a href="#chain">
<span class="tocnumber"></span> <span class="toctext">Project goal</span></a></li>
<ul>
<li class="toclevel-2"><a href="#Flower">
<span class="tocnumber"></span> <span class="toctext">First stage:Sensing system</span></a></li>
<li class="toclevel-2"><a href="#sensing">
<span class="tocnumber"></span> <span class="toctext">Second stage:Amplification system</span></a></li>
<ul>
<li class="toclevel-3"><a href="#5">
<span class="tocnumber"></span> <span class="toctext">DNA origami approach</span></a></li>
<li class="toclevel-3"><a href="#6">
<span class="tocnumber"></span> <span class="toctext">Flower DNA approach</span></a></li>
</li>


<h4>The second layer: “temperature-sensitive liposomes”</h4>
The temperature-sensitive liposomes contain PNIPAM lipids in their membrane. Temperature shift causing hydrophobicity change of the PNIPAM induces collapse of the liposomes (See


<a href="#Characters of the PNIPAM molecular">“Characters of the PNIPAM molecular”</a>
</ul>
</li>
</ul>
</td></tr></table>


). The temperature-sensitive liposomes encapsulate a chelate compound (EGTA) and DNAs.<br><br>  
<h2 id=chain>Project goal</h2>
&nbsp;In Lipo-HANABI project, we need to develop the following two subsystems.<br><br>


The two layers realize a dual disruption system as follows (Fig.1). The first is “liposome disruption” by increasing temperature. The second is “disruption of alginate membrane” by chelating reagent (EGTA) of calcium released from the liposomes disrupted. This system enables to release many trigger DNAs at a limited point.<br><br>
i) Sensing system (First stage): liposome disruption by temperature control. <br>


1.The alginate gel membrane encapsulates many temperature-sensitive liposomes.<br>
ii) Amplification system (Second stage): a chain-reactive disruption of the liposomes activated by the First stage. <br><br>
Please refer following link(
<a href="http://www.sigmaaldrich.com/etc/medialib/docs/SAJ/Brochure/1/j_recipedds2.Par.0001.File.tmp/j_recipedds2.pdf">pdf</a>
).<br>
2.
Warming the temperature-sensitive liposomes from room temperature to over 32 ºC causes disruption of the liposomes.<br>
3.
The liposome disruption release DNAs and EGTA (and urea) which chelate calcium. Lowering calcium concentration starts to melt the alginate gel membrane. During this process, DNA origami is formed when urea is added.<br>


4.
<h3 id=Flower>First stage: Sensing system </h3>
As a result of the melting, trigger DNAs (DNA origami structure or DNA strands for the flower micelle approach (See design:
&nbsp;The purpose of First stage is to detect temperature change and release key molecules for the Second stage. This is achieved by temperature-sensitive liposomes containing &nbsp;the keys. To make the liposome, we used lipids conjugated with NIPAM polymer.<br>
&nbsp;This structural change of NIPAM induces stress on the surface of the liposome, and consequently disrupts them.<br>
<div align="center">
<Img Src="http://openwetware.org/images/9/95/NIPAM%E3%83%AA%E3%83%9D%E3%81%A1%E3%82%83%E3%82%933.png">
</div>
<div class="caption">Fig.1 Temperature-sensitive liposome</div>
<h3 id=sensing>Second stage: Amplification system </h3>
&nbsp;The purpose of Second stage is to accept the key from the First stage and release a lot of payload molecules in a chain-reaction. <br>
&nbsp;There are two different approaches to realize the Second stage.<br>
  A) DNA Origami approach<br>
  B) Flower DNA approach<br>


<a href="#chain-reactive burst"> chain-reactive burst</a>
<h4 id=5>DNA origami approach </h4>


)) are released from the melted alginate membrane.<br>


<h4>An application to DNA origami formation using the dual disruption system</h4>
This dual structure enables to spontaneous formation of DNA origami through environmental stimulation. Three components, Urea (a denature reagent of DNA nanostructure) and materials of DNA origami and EGTA, can be encapsulated in liposomes. It takes times (several hours) to melt the gel membrane by EGTA released from the temperature-sensitive liposomes. Because small molecules can diffuse in alginate gels, urea inside alginate is expected to be gradually diluted during the melting. DNA origami could be formed through the dilution of urea (See


&nbsp;This approach is inspired by a paper about <a Href="http://www.ncbi.nlm.nih.gov/pubmed/19780639"> Membrane-bending proteins (Prinz WA, Hinshaw JE., Crit Rev Biochem Mol Biol., 2009)</a>.
In this approach,　we use “Origami-anchor DNA” which connects DNA Origami with liposome membrane.


A lot of DNA origamis are adsorbed on the surface of liposomes by using Origami-anchor DNA. DNA origami is supposed to be a stiff, straight board compared with liposome membrane, and as a result, liposome surface gets bending stress. At certain level of the absorbance, liposomes will burst. Also, DNA origamis on the surface repel each other because of negative charges on DNA backbones. This effect may add more stress on the membrane.<br>


<a href="#DNA origami formation through urea dilution">“DNA origami formation through urea dilution”</a>
<div align="center">
 
<Img Src="http://openwetware.org/images/c/c5/%E8%86%9C%E3%80%80%E5%8F%8D%E7%99%BAdfhr.png">
 
</div>
).<br><br>
<div class="caption">Fig.2 Stress on liposome membrane</div>
 
<h5>※Principle of this system</h5>
<h5>Alginate gels</h5>
Alginate is widely used in foods additives and drug stabilizers. <br>Sodium alginate is the neutral salt which an alginate carboxyl group coupled with a Na+. It dissolves in water well and becomes water solution with the high viscosity.
If Ca2+ is added to the sodium alginate solution, ion bridging happens instantly and gelation happen. And If Chelating reagent (for example EDTA, EGTA) is added to alginate hydrogel, Ca2+ is robbed and gel collapse.
<br>
<br>
&nbsp;From the reference, we learned that efficient structure design for destabilizing membranes should have the following properties: <br>
<ur><li>Having rigid scaffolds</li>
<li>Having large surface areas to maximize the effect of the scaffold on the membrane</li></ur>


<img src="http://openwetware.org/images/d/d2/Alginate-gel_2.png"><br>
<Design of DNA origami><br>
Fig.2 A image about Gelation and Solation of alginate gel<br><br>
&nbsp;DNA origami is known as a designable rigid structure made of DNA. We use DNA origami to make the rigid scaffolds. In order to meet the requirements, we designed a 2D rectangular DNA origami.<br>


<a name="Characters of the PNIPAM molecular"></a>
<div align="center">
<h5>Characters of the PNIPAM molecular</h5>
<Img Src="http://openwetware.org/images/4/45/Outsidefig8.png">
 
</div>
Hydrophobicity of NIPAM varies at temperatures. NIPAM is hydrophilic at less than 32 ºC, but it become hydrophobic and shrinks at > 32 ºC. Therefore, liposomes containing a modified NIPAM (poly(NIPAM-co-AA-co-ODA) in their membranes become unstable at high temperature (temperature-sensitive liposomes). Consequently, increasing temperature disrupt the liposomes.<br>
<div class="caption">Fig.3 Rectangular origami</div>
Reference(
<a href=
"http://www.sigmaaldrich.com/etc/medialib/docs/SAJ/Brochure/1/j_recipedds2.Par.0001.File.tmp/j_recipedds2.pdf">pdf</a>)
<br>
 
 
<div align="center"><img src="http://openwetware.org/images/d/df/PNIPAM-function-02.png" width="600"></div><br>
Fig.3 A schematic image how liposome containing PNIPAM disrupt at high temperature is shown.<br><br>
 
<a name="DNA origami formation through urea dilution"></a>
 
 
 
 
<h5>DNA origami formation through urea dilution</h5>
 
Polarity of water molecular becomes weak in the presence of urea. Thus, urea interrupts the hydrogen bond of DNA bases. For the reason, the melting point of DNA hybridization decreases. Thus, gradually decreasing the concentration of urea enables to form DNA origami structure under isothermal condition.<br>
 
<img src="http://openwetware.org/images/4/4b/Nyoso.png"><br>
Fig.4 A image about denaturation by urea
 
 
</article>
 
 
 
  <article data-title="Chain-reactive burst">
 
<h3 id="chain">Chain-reactive burst</h3></br>
<br>
We designed “chain-reactive burst” system as follows.<br>
Each liposome contains triggers and drugs inside, and aptamers for the trigger on its surface.  When liposomes are destroyed, new triggers and drugs are released. To achieve liposomal burst by outside triggers, we propose the following two approaches. <br>
<br>
<li> <h5>i) Bending approach</h5></li>
<li> <h5>ii) Flower micelle approach</h5></li>
<br>
First, we considered a theory to disrupt liposomes by a trigger DNA signal through calculation. If a liposome is destroyed, its size becomes smaller. We estimated the free energy gap between the two liposomal states: a large liposome and a small one. And  discuss which size of liposomes is more stable.<br>
Please see the details (Go to <a href=” http://openwetware.org/wiki/Biomod/2013/Sendai/caluculation”>Calculation</a>).<br>
 
<h4> i)Bending Approach</h4><br>
 
<Img Src="http://openwetware.org/images/f/f2/Design-bending-flow.png" Align="center" width="900px" ><br>
<div align="center">Fig.1 Process of bending approach</div><br>
<br>
Our bending approach consists of the following four steps.<br>
1.Cholesterol-conjugated DNA strands (in the rest of this document, referred to as “aptamer”) attaches to the surfaces of liposomes.<br>
2. Then, DNA origami complementary to the aptamer is added as triggers.<br>
3. Triggers bind to the surfaces of liposomes and give a load on the membrane.<br>
4. Due to the load by triggers, liposomes are destroyed.<br>
<br>
 
<h5>a) Mechanism of bending membranes</h5>
To destroy liposomes, we focused on the mechanism the living things use to bend cell membranes. We consider that if we could make use of the mechanism of bending membranes (destabilizing membranes), it would lead to the collapse of membranes. The following three mechanisms have been proposed as of now (<A Href="http://www.ncbi.nlm.nih.gov/pubmed/19780639">Membrane-bending proteins</A>)<br>
 
<div class="caption-left">
<Img Src="http://openwetware.org/images/a/ae/Designfig2.png" width="280px" height="400px">
<span>Fig.2 Mechanism of bending membranes</span></div>
<br>
The mechanism A is that amphipathic molecules are inserted into the cell membrane and the bending is caused. The inner hydrophobic part of the lipid bilayer has a strong adhesive power for the two leaflets. Thus, once the amphipathic molecules are inserted into one leaflet of the membrane and expand it, the other leaflet bends according to it, making its surface area smallest.<br>
<br>
The mechanism B is that the molecule attached to the membrane becomes a rigid scaffold and distort the membrane under itself, or stabilize the already bended membrane.<br>
<br>
The mechanism C is that lipid molecules are clustered in one leaflet of the membrane and the inequality of lipid quantity makes the membrane bend.<br>
<div class="c-both"></div>
 
Most membrane bending proteins combine the above three mechanisms.<br>
In addition, a theory that protein crowding causes the bending of cell membranes ( <A Href="http://www.ncbi.nlm.nih.gov/pubmed/22902598">Membrane bending by protein- protein crowding</A>) has recently been suggested. This mechanism is that the collision of membrane proteins produces lateral pressure on membranes and distorts them.<br>
<br>
Due to the above reasons, the efficient design for destabilizing membranes is the structures that :<br>
<ur><li>have rigid scaffolds</li>
<li>have large surface areas to maximize the effect of the scaffold on the membrane</li>
<li>produce a large pressure by collisions</li></ur>
<br>
<h5>b) Rigid scaffolds</h5>
To make rigid scaffolds, we took note of DNA origami, because DNA origami is a method for making rigid structures of any shape. Moreover, we adopted a 2D structure to make the surface area largest.<br>
 
<br>
We also designed rectangle and triangle to make the pressure of the collision highest.<br>
<Img Src="http://openwetware.org/images/6/63/Outsidefig3.png">
<br>
<div align="center">Fig.3 Rectangle origami and triangle origami</div><br>
We suppose that rectangle and triangle structures are most effective for the following reasons. <br>
Rectangle is expected to work as one scaffold in itself; triangle (the most efficient figure that covers a sphere) structures, to gather and work as one big rigid scaffold.<br>
<br>
The design of our rectangular DNA origami is as below.<br>
<Img Src="http://openwetware.org/images/6/6e/Outsidefig4.png">
<div align="center">Fig.4 Rectangular origami</div>
<br>
<br>
<div class="caption-right">
<div class="caption-right">
  <Img Src="http://openwetware.org/images/a/a7/Lipo5.png" ><span>Fig.5 DNA origami designed by caDNAno</span>
  <Img Src="http://openwetware.org/images/a/a7/Lipo5.png" style="padding-left:10mm"><span>Fig.4 DNA origami designed by caDNAno</span>
</div>
</div>
We used caDNAno for our DNA origami design.<br>
&nbsp;We use <a href="http://cadnano.org/">caDNAno2</a> for our DNA origami design.  
The DNA origami has a rectangle shape of 67.6nm (26 helixes) by 127 nm (374 bases).<br>
The size of DNA origami is 67.6nm (26 helixes) in width and 127 nm (374 bases) in height.
We cut out a smaller rectangle of 10 helixes by 161 bases at one edge of this origami, so that we could distinguish the two sides during AFM (Atomic Force Microscope) observation.<br>
We cut out a smaller rectangle of 10 helixes (161 bases) at one of the corners,
Besides, to destabilize the membrane by inserting this origami, we designed 141 staples at the center of the origami to hybridize with aptamers (These aptamers give our origami amphipathicity), and enabled it to insert into the membrane.  
so that we could distinguish the two sides with AFM (Atomic Force Microscope) observation.  
Also, we put 141 staples sticking out from the bottom face of the origami.
Those staples hybridize with cholesterol-modified Origami-anchor DNA, which has high affinity with lipid membrane.<br>
<br>
<br>
<div class="c-both"></div>
<div align="center">
To sum up, the aptamer not only connects DNA origami and liposomes but also inserts into the membrane and destabilizes it.<br>
<Img Src="http://openwetware.org/images/a/a0/Outsidefig5rg.png"　width="450px" height="350px">
 
</div>
<Img Src="http://openwetware.org/images/c/c5/Outsidefig5.png">
<div class="caption">Fig.5 Unstable liposome</div>
<div align="center">Fig.6 Unstable liposome</div>
<br><br>
<br>  
<h4 id=6>Flower DNA approach</h4>
<h4>ii)Flower micelle approach</h4><br>
&nbsp;This approach is inspired by a paper about <a href="http://pubs.acs.org/doi/ipdf/10.1021/jp104711q">Polymer Flower-micelle (Yukio Tominaga, Mari Mizuse, Akihito Hashidzume, Yotaro Morishima and Takahiro Sato, J. Phys. Chem. B, 2010)</a>.
<Img Src="http://openwetware.org/images/8/8f/Design-flower-flow.png" Align="center" width="900px" ><br>
To adapt the Polymer Flower-micelle to our project, the followings are required.<br><br>
<div align="center">Fig.7 Process of flower micelle approach</div><br>
<ur><li>Embedding a lot of cholesterol-modified ss DNA on the liposome surface</li>
 
<li>Adding another ssDNA (complementary to the above DNA) which induces a structural change　by DNA hybridization</li>
<div class="caption-right">
<li>The induced structural change on the DNA results in disruption of the liposome</li>
<Img Src="http://openwetware.org/images/6/6f/Design-flowermicelle.png" style="width:425px;"><span>Fig.8 Flower micelle method</span></div>
There is a method called flower micelles for collapsing liposomes. <br>
In this method, we cover the surface of the micelles with many copolymer rings, heat and distort the rings, and produce pressure on the micelle and collapse them.<br>
We tried to collapse liposomes by applying the basis of flower micelles.<br>
<div class="c-both"></div>
<br>
<br>
1. First, we mix aptamer (the same strand as used in i) Bending approach), loop strands, and liposomes.<br>
&nbsp;At first, we designed “Flower-anchor DNA”, which is a couple of ss DNAs both having cholesterol modified groups (Fig.6): Flower-anchor1 is 10nt ss DNA and Flower-anchor2 is 50nt ss DNA. Both are cholesterol-modified at their 3’ ends. <br>
The loop strand is designed to have two complementary parts to the aptamers at its both ends. So when it binds to the aptamers, it is expected to make a loop between its both ends. <br>
&nbsp;In addition, the 5’ end of the Flower-anchor2 is complementary to Flower-anchor1. When they hybridize, the rest 40nt of Flower-anchor2 remains single-stranded.<br><br>
The complex of the aptamers and loop strand floats on the surface of the liposomes.<br>
<div align="center">
<Img Src="http://openwetware.org/images/a/aa/Flower2.png">  
<Img Src="http://openwetware.org/images/3/3d/Flower-newfg.png" width="450px" height="350px" ></div><br>
<div class="caption">Fig.6 Liposome with Flower-anchor DNA</div>
<br>
<br>
<div align="center">Fig.9 Make loops on the surface of the liposomes</div>
&nbsp;The key DNA released from stage 1 liposome is complementary to this single-stranded part. When the key hybridizes on it, a double-stranded section is formed. The length of the section is shorter than its persistence length; therefore it works as a rigid strut. The strut is anchored on the liposome at both ends, thus it extends the membrane. As a consequence, this may lead to drastic conformational change of the liposome, namely, disruption. <br><br>
<br>
<div align="center">
2. Next, we add complementary trigger strand to the loop strand. The trigger strand hybridizes with the loop strand.<br>
<img src="http://openwetware.org/images/6/65/Flower3new8.png" width="70%" hight="800"><br>
<br>
<div class="caption">Fig.7 Process of flower DNA approach</div><br><br>
3. And then the strands keep straight, because we designed the trigger strand shorter than its persistence length.<br>
<Img Src="http://openwetware.org/images/1/17/Flor4.png" width="70%" hight="800" ><br>
<img src="http://openwetware.org/images/0/03/Flower3.png"><br>
<div class="caption">Fig.8 How to disrupt a liposome</div>
<div align="center">Fig.10 How to straighten loop</div>
      </article>
4.This process gives pressure on the liposome and collapses them.<br>
</section>
<Img Src="http://openwetware.org/images/3/3b/Flower4.png"><br>
<div align="center">Fig.11 Liposome burst</div>
<br>
We consider if some triggers are kept inside the liposomes and the liposomal membrane is broken by the above i) and ii) methods from the outside, it would be much easy to begin the chain reaction. <br>
<br>
We designed the DNA sequence for this approach by <A Href="http://www.dna.caltech.edu/DNAdesign/">DNA design</A>, software for designing DNA sequences. <br>
We arranged three kinds of DNA strands that hybridize with the surface of liposomes via aptamer. <br>
Each has 40nt, 20nt, and 10nt loop parts (shown below as blue parts). <br>
The blue parts are complementary to the blue trigger strands, and when they hybridize, they place some stress on the liposome and collapse it. <br>
The red parts are for hybridizing with liposomes. They are complementary to the aptamer on the surface of liposomes. <br>
The aptamer is the same as that used in i)Bending approach.<br>
<font size="-2">
Aptamer DNA<br>
<font color="red">CCAGAAGACG</font> -cholesterol<br>
40nt loop DNA<br>
<font color="red">CGTCTTCTGG</font>TTTTTTTTTT<font color="blue">GCGAACCACGGTTCCCAGCGTGACCTTCATGCTTAAGTTT</font><font color="red">CGTCTTCTGG</font><br>
Trigger DNA for 40 nt loop DNA<br>
<font color="blue">AAACTTAAGCATGAAGGTCACGCTGGGAACCGTGGTTCGC</font><br>
20nt loop DNA<br>
<font color="red">CGTCTTCTGG</font>TTTTTTTTTTTT<font color="blue">CATAACATGAGGCGCCGT</font><font color="red">CGTCTTCTGG</font><br>
Trigger DNA for 20 nt loop DNA<br>
<font color="blue">ACGGCGCCTCATGTTATGAA</font><br>
10nt loop DNA<br>
<font color="red">CGTCTTCTGG</font>TTTTTTTTTT<font color="blue">CTGTAACTAA</font><font color="red">CGTCTTCTGG</font><br>
Trigger DNA for 10 nt loop DNA<br>
<font color="blue">TTAGTTACAG</font><br>
</font>
 
        </article>
 
 
 
    </section>
<!-- /***** </div> ****/ -->
<!-- /***** </div> ****/ -->
    
    
Line 286: Line 174:
</body>
</body>
</html>
</html>


{{Biomod/2013/Sendai/sandbox/template2}}
{{Biomod/2013/Sendai/sandbox/template2}}

Latest revision as of 22:54, 26 October 2013

<html> <head> <style>


/********************** Hide MediaWiki and init CSS, overwrite by bootstrap.css バルス**********************/

body{ 

background:none;

} html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, embed, figure, figcaption, footer, header, hgroup, menu, nav, output, ruby, section, summary, time, mark, audio, video{ 

margin:0;
padding:0;
/* font-size:100%; */
 border:0;
outline:0;

} a, a:link, a:visited, a:hover, a:active{ 

text-decoration:none

}

/*訪れたリンクを白くするよ*/ .whiteSendai:visited{ 

color:#FFFFFF!important;

}

/*左詰め、真ん中、右詰め*/ .leftSendai { text-align: left; } .centerSendai { text-align: center; } .rightSendai { text-align: right; }


.firstHeading { 

display:none;

}

  1. content{
border-style:none;
margin:0;
padding:0;

}

  1. globalWrapper{
font-size:100%;

}

  1. contentSub{
display:none;

}

  1. column-one{
display:none;

}

  1. footer{
display:none;

}

  1. globalWrapper{
font-size:100%;

}

  1. bodyContent h1, #bodyContent h2{
 margin-top: 20px;
 margin-bottom: 10px;

}


  1. bodyContent h3{
 margin-top: 20px;
 margin-bottom: 10px;
 border-bottom-width: medium;
 border-bottom-style: solid;
 border-bottom-color: gray;

}

  1. bodyContent h4{
 margin-top: 20px;
 margin-bottom: 10px;
 border-bottom-width: thin;
 border-bottom-style: solid;
 border-bottom-color: gray;

}

  1. bodyContent h5, #bodyContent h6{
 margin-top: 10px;
 margin-bottom: 10px;

/**** border-bottom-width: thin; 

 border-bottom-style: solid;
 border-bottom-color: gray;
        • /

}

/********************************* Hide MediaWiki end *********************************/


/* Structure */ html{ background: #eee; } body { 

 padding: 0px;
 background: #fff;
 color: #333;
 margin: 0 auto;
 max-width: 900px;
 font: 1em/1.5 "Helvetica Neue", Helvetica, Arial, sans-serif;
 }

a { 

 color: #105672;

}

header {/****position: fixed; ****/ 

       /******width: 100%;****/
       height: 90px;
       z-index: 1;

background: #F17F25; 

        padding:0.01em 0.5em 1.5em ;

color: #fff; line-height: 1;

}

header h1{ margin-bottom: 0; }

header h1 span{ display: inline; color: rgba(255,255,255,.4); }

header span{ display: block; color: rgba(255,255,255,.2); font-weight: 300; margin-bottom: 1.6em }

header nav{ float: right; text-align: right } header nav div{ font-size: .8em; } header nav div a { font-weight: 300; padding: .3em .5em } header nav a{ color: #fff; display: inline-block; padding: .3em .8em }

header nav a:hover, header nav a:focus{ color: rgba(255,255,255,.6) }


[role=main]{ padding:1.5em 3em; } article{ padding: 1em 0; text-align: justify; text-justify: inter-ideograph;

}


footer{ background: #333; color: #fff; padding: 1em 3em; 

       clear: both;    /***2段組みの左右のfloatを解除***/

}

/* Typography */

p{ font: 1em/1.5 Palatino, "Palatino Linotype", Georgia, Times, "Times New Roman", serif; }

p.sukima{ 

       font-size: 150%;
       font-weight: normal;
       font-family: Helvetica;
       background: #bbb;
       padding-left: 1.2em;

}

img{ max-width: 100%; /***** height: auto; *****/ }


blockquote{ float: left; margin: 1em 3em; } blockquote p{ font-size: 1.4em; line-height: 1.2; font-weight: 700; font-style:italic; } a{ font: 700 1em/1.5 "Helvetica Neue", Helvetica, Arial, sans-serif; text-decoration: none } a:hover, a:focus{ color: #000; } a:active{ position: relative; top:1px; }

ol{margin: 1em 0 1em 0; padding-left: 2em; } li{ margin: 0; }

/* Tabs */

  1. tabs

{ /*****position:fixed;****/ 

      width: 900px;

}

.js-on #tabs article { display:none }

  1. tabs, #tabs nav a.active{

background: #FFF; color: #111; }

  1. tabs nav

{ position: relative; overflow: hidden; display: table; background: #bbb; }


  1. tabs nav a

{ width:900px; display:table-cell; padding:1em; text-align:center; color: #333; }

  1. tabs nav a:hover,#tabs nav a:focus

{ background:#eee }

  1. tabs article

{ padding:2em; }


.js-on #tabs article.active { display:block; }

  1. tabs #mobiles{

display:none; border-radius: 0; }

  1. tabs #mobiles a, #tabs #mobiles a:first-child, #tabs #mobiles a:last-child{

width:300px; border-radius: 0; }


/* Media queries */ @media screen and (min-width:900px) { body{font-size: 1.1em;} }

@media screen and (max-width:600px) { #tabs nav{ display: none; position: relative; } #tabs #mobiles{ display:block; } #tabs article { display:block; } } @media screen and (max-width:480px) { blockquote{ float: none; }

header nav a{ padding:.7em .8em } header nav{ float: none; margin: -.5em -3em 0; background: #000; overflow: hidden; text-align: left } header nav a{ border-right: 1px solid #222 } [role=main]{ padding:1.5em 2em; } header nav div{ display: none; }

}

/*column content*/

  1. content-right {

width:48%; /***段落の横幅***/ float:right; /***右に寄せる（他の要素を左に回り込ませる)***/ margin: 10px; }

  1. content-left {

width:47%; /***サイドの横幅***/ float:left; /***左に寄せる***/ margin: 10px; }

/*****キャプションレフト*****/

div.caption-left{ float: left; padding: 0 5px 5px 5px; }

.caption-left span{ display: block; text-align: center; 

       font-size: smaller;
       font-weight: bold;

}

div.clear{ clear: both; margin: 0 0 10px 0; }

/*****キャプションライト*****/

div.caption-right{ float: right; padding: 0 5px 5px 5px; }

.caption-right span{ display: block; text-align: center; 

       font-size: smaller;
       font-weight: bold;

}

div.clear{ clear: both; margin: 0 0 10px 0; } 

/***floatの影響を絶つ。<div class="c-both"></div> のように使う***/

.c-both { clear: both; }

div.title{ 

        font-style: normal;
        font-weight: bold;
        font-size: 70px;
        line-height: 70px;
        font-family: Helvetica;

}

div.caption{ 

       text-align: center;
       font-size: smaller;
       font-weight: bold;

}

div.captiontable{ 

       font-size: smaller;
       font-weight: bold;

}

/*topに戻る*/

  1. ttop {position:fixed;
      bottom:140px;
      left:auto;margin:0 0 0 905px; /* マージン：上 右 下 左 */
      width:100px;
      height:390px;
      background:url(http://openwetware.org/images/f/f2/%E5%90%8D%E7%A7%B0%E6%9C%AA%E8%A8%AD%E5%AE%9A-1.png) no-repeat left bottom;}

/* IE6以下用、アスタリスクハックでググれ */

  • html #ttop {margin:0 0 -390px 0;
             position:relative;bottom:490px; /* 上で設定した ttopの高さ390px＋下100px */
             left:960px;}
  1. ttop:hover {background:url(http://openwetware.org/images/b/b9/Top2.png) no-repeat left bottom;/* 画像の高さによって適当に調整 */
            }

a.page_top {display:block;width:100px;height:390px;}


</style> </head> </html> <html xmlns="http://www.w3.org/1999/xhtml"> <head> 

   <title>Biomod2013 Sendai ver2.0</title>
   <meta name="viewport" content="width=device-width,initial-scale=1">
   
   <style type="text/css">
   h1{color: white;}
   </style>

</head>

<body> <!-- <div style="max-width:900px; position:fixed;">****/ --> 

   <header>

        <nav>      
          <div>

<!-- 

               <a href="#"  class="whiteSendai">Blog</a> 
               <a href="#"  class="whiteSendai">Twitter</a>
               <a href="#"  class="whiteSendai">Facebook</a>

--> <br><br> 

           </div>
          <a href="http://openwetware.org/wiki/Biomod/2013/Sendai" class="whiteSendai">Top</a> 
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/project" class="whiteSendai">Project</a>
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/design" class="whiteSendai">Design</a> 
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/calcuation" class="whiteSendai">Calculation</a>
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/experiment" class="whiteSendai">Experiment</a>

<a href="http://openwetware.org/wiki/Biomod/2013" class="whiteSendai" style="float:right;"><img src="http://openwetware.org/images/6/6e/Biomod-logo.jpg" 

                                              width="75" height="75" alt="Biomod2013" border="0"></a><br>
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/protocol" class="whiteSendai">Protocol</a>   
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/future" class="whiteSendai">Future</a> 
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/member" class="whiteSendai">Member</a>
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/sponsor" class="whiteSendai">Sponsor</a>
           </nav>
            <a href="http://openwetware.org/wiki/Biomod/2013/Sendai"><h1 style="color:white;" ><b>Biomod<span>2013<br>&emsp; Team</span>Sendai</b></h1></a>

</header>

<div id="ttop"> <a href="#top" class="page_top" onfocus="this.blur();" onclick="scrollTo(0,0); return false;" title="Top"></a></div> 

<section role="main">
       <article>
        <h2>Design</h2>

<table id="toc" class="toc" summary="Contents"><tr><td><div id="toctitle"><h2>Contents</h2></div> <ul> <li class="toclevel-1"><a href="#chain"> <span class="tocnumber"></span> <span class="toctext">Project goal</span></a></li> <ul> <li class="toclevel-2"><a href="#Flower"> <span class="tocnumber"></span> <span class="toctext">First stage:Sensing system</span></a></li> <li class="toclevel-2"><a href="#sensing"> <span class="tocnumber"></span> <span class="toctext">Second stage:Amplification system</span></a></li> <ul> <li class="toclevel-3"><a href="#5"> <span class="tocnumber"></span> <span class="toctext">DNA origami approach</span></a></li> <li class="toclevel-3"><a href="#6"> <span class="tocnumber"></span> <span class="toctext">Flower DNA approach</span></a></li> </li>


</ul> </li> </ul> </td></tr></table>

<h2 id=chain>Project goal</h2> &nbsp;In Lipo-HANABI project, we need to develop the following two subsystems.<br><br>

i) Sensing system (First stage): liposome disruption by temperature control. <br>

ii) Amplification system (Second stage): a chain-reactive disruption of the liposomes activated by the First stage. <br><br>

<h3 id=Flower>First stage: Sensing system </h3> &nbsp;The purpose of First stage is to detect temperature change and release key molecules for the Second stage. This is achieved by temperature-sensitive liposomes containing &nbsp;the keys. To make the liposome, we used lipids conjugated with NIPAM polymer.<br> &nbsp;This structural change of NIPAM induces stress on the surface of the liposome, and consequently disrupts them.<br> <div align="center"> <Img Src="http://openwetware.org/images/9/95/NIPAM%E3%83%AA%E3%83%9D%E3%81%A1%E3%82%83%E3%82%933.png"> </div> <div class="caption">Fig.1 Temperature-sensitive liposome</div> <h3 id=sensing>Second stage: Amplification system </h3> &nbsp;The purpose of Second stage is to accept the key from the First stage and release a lot of payload molecules in a chain-reaction. <br> &nbsp;There are two different approaches to realize the Second stage.<br> 

  A) DNA Origami approach<br>
  B) Flower DNA approach<br>

<h4 id=5>DNA origami approach </h4>


&nbsp;This approach is inspired by a paper about <a Href="http://www.ncbi.nlm.nih.gov/pubmed/19780639"> Membrane-bending proteins (Prinz WA, Hinshaw JE., Crit Rev Biochem Mol Biol., 2009)</a>. In this approach,　we use “Origami-anchor DNA” which connects DNA Origami with liposome membrane.

A lot of DNA origamis are adsorbed on the surface of liposomes by using Origami-anchor DNA. DNA origami is supposed to be a stiff, straight board compared with liposome membrane, and as a result, liposome surface gets bending stress. At certain level of the absorbance, liposomes will burst. Also, DNA origamis on the surface repel each other because of negative charges on DNA backbones. This effect may add more stress on the membrane.<br>

<div align="center"> <Img Src="http://openwetware.org/images/c/c5/%E8%86%9C%E3%80%80%E5%8F%8D%E7%99%BAdfhr.png"> </div> <div class="caption">Fig.2 Stress on liposome membrane</div> <br> &nbsp;From the reference, we learned that efficient structure design for destabilizing membranes should have the following properties: <br> <ur><li>Having rigid scaffolds</li> <li>Having large surface areas to maximize the effect of the scaffold on the membrane</li></ur>

<Design of DNA origami><br> &nbsp;DNA origami is known as a designable rigid structure made of DNA. We use DNA origami to make the rigid scaffolds. In order to meet the requirements, we designed a 2D rectangular DNA origami.<br>

<div align="center"> <Img Src="http://openwetware.org/images/4/45/Outsidefig8.png"> </div> <div class="caption">Fig.3 Rectangular origami</div> <br> <div class="caption-right"> 

<Img Src="http://openwetware.org/images/a/a7/Lipo5.png" style="padding-left:10mm"><span>Fig.4 DNA origami designed by caDNAno</span>

</div> &nbsp;We use <a href="http://cadnano.org/">caDNAno2</a> for our DNA origami design. The size of DNA origami is 67.6nm (26 helixes) in width and 127 nm (374 bases) in height. We cut out a smaller rectangle of 10 helixes (161 bases) at one of the corners, so that we could distinguish the two sides with AFM (Atomic Force Microscope) observation. Also, we put 141 staples sticking out from the bottom face of the origami. Those staples hybridize with cholesterol-modified Origami-anchor DNA, which has high affinity with lipid membrane.<br> <br> <div align="center"> <Img Src="http://openwetware.org/images/a/a0/Outsidefig5rg.png"　width="450px" height="350px"> </div> <div class="caption">Fig.5 Unstable liposome</div> <br><br> <h4 id=6>Flower DNA approach</h4> &nbsp;This approach is inspired by a paper about <a href="http://pubs.acs.org/doi/ipdf/10.1021/jp104711q">Polymer Flower-micelle (Yukio Tominaga, Mari Mizuse, Akihito Hashidzume, Yotaro Morishima and Takahiro Sato, J. Phys. Chem. B, 2010)</a>. To adapt the Polymer Flower-micelle to our project, the followings are required.<br><br> <ur><li>Embedding a lot of cholesterol-modified ss DNA on the liposome surface</li> <li>Adding another ssDNA (complementary to the above DNA) which induces a structural change　by DNA hybridization</li> <li>The induced structural change on the DNA results in disruption of the liposome</li> <br> &nbsp;At first, we designed “Flower-anchor DNA”, which is a couple of ss DNAs both having cholesterol modified groups (Fig.6): Flower-anchor1 is 10nt ss DNA and Flower-anchor2 is 50nt ss DNA. Both are cholesterol-modified at their 3’ ends. <br> &nbsp;In addition, the 5’ end of the Flower-anchor2 is complementary to Flower-anchor1. When they hybridize, the rest 40nt of Flower-anchor2 remains single-stranded.<br><br> <div align="center"> <Img Src="http://openwetware.org/images/3/3d/Flower-newfg.png" width="450px" height="350px" ></div><br> <div class="caption">Fig.6 Liposome with Flower-anchor DNA</div> <br> &nbsp;The key DNA released from stage 1 liposome is complementary to this single-stranded part. When the key hybridizes on it, a double-stranded section is formed. The length of the section is shorter than its persistence length; therefore it works as a rigid strut. The strut is anchored on the liposome at both ends, thus it extends the membrane. As a consequence, this may lead to drastic conformational change of the liposome, namely, disruption. <br><br> <div align="center"> <img src="http://openwetware.org/images/6/65/Flower3new8.png" width="70%" hight="800"><br> <div class="caption">Fig.7 Process of flower DNA approach</div><br><br> <Img Src="http://openwetware.org/images/1/17/Flor4.png" width="70%" hight="800" ><br> <div class="caption">Fig.8 How to disrupt a liposome</div> 

      </article>

</section> <!-- /***** </div> ****/ --> 


   <footer>
       <p>&copy; Copyright Biomod 2013 Team Sendai
               <a href="http://www.molbot.mech.tohoku.ac.jp/index.html">

　　　　　　　　　　　　　　　　　　<img src="http://openwetware.org/images/3/36/Murata-nomura-logo.png" 

                                     width="180" height="50" alt="Molcular Robotics Lab" border="0" align="right">

　　　　　　　　 </a> 　　　　 </p> 

       <p>E-MAIL:
           <a href="mailto:biomod.teamsendai.2012@gmail.com">biomod.teamsendai.2012@gmail.com
           </a>
       </p>
       <br>
       <a href="?action=edit" align="center"><p>edit</p></a>
   </footer>

</body> </html>


<html> <head> 

       <script type="text/javascript">
     function tabs(a,g,j){document.body.className="js-on";var g=a.getElementsByTagName(g),d=[],c;this.active;this.total=g.length;this.container=a;e=a.insertBefore(document.createElement("nav"),g[0]),change=function(f){if(typeof this.active!=="undefined"){d[this.active].className=g[this.active].className=""}d[f].className=g[f].className="active";this.active=f},clickEvent=function(h,f){h.onclick=function(){change(f);return false}};for(var b=0;b<g.length;b++){d[b]=e.appendChild(document.createElement("a"));d[b].href="#";c=[g[b].getAttribute("data-title"),g[b].getElementsByTagName(j)[0]];d[b].innerHTML=c[0]!==null?c[0]:c[1]?c[1]["innerText"||"textContent"]:b+1;new clickEvent(d[b],b)}change(0)}tabs.prototype.change=function(b){change(b-1)};tabs.prototype.next=function(b){active===this.total-1?change(0):change(active+1)};tabs.prototype.prev=function(b){active===0?change(this.total-1):change(active-1)};tabs.prototype.responsive=function(d,c){nav=document.createElement("nav");nav.id="mobiles";nav.innerHTML='<a href="#" onclick="'+d+'.prev(); return false">'+c.prev+'</a><a href="#" onclick="'+d+'.next(); return false">'+c.next+"</a>";this.container.insertBefore(nav,this.container.firstChild);return this};
       </script>
       <script type="text/javascript">

var myTabs = new tabs(document.getElementById("tabs"), "article", "h2").responsive("myTabs", { prev: "Previous", next: "Next" }); </script> </head> </html>

Retrieved from "https://openwetware.org/mediawiki/index.php?title=Biomod/2013/Sendai/design&oldid=750348"