Biomod/2013/Sendai/design: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
(180 intermediate revisions by 3 users not shown)
Line 41: Line 41:


</header>  
</header>  
<p class="sukima"> Design
</p>


<div id="ttop">
<a href="#top" class="page_top" onfocus="this.blur();" onclick="scrollTo(0,0); return false;" title="Top"></a></div>


<section role="main">
        <article>
        <h2>Design</h2>


<table id="toc" class="toc" summary="Contents"><tr><td><div id="toctitle"><h2>Contents</h2></div>
<ul>
<li class="toclevel-1"><a href="#chain">
<span class="tocnumber"></span> <span class="toctext">Project goal</span></a></li>
<ul>
<li class="toclevel-2"><a href="#Flower">
<span class="tocnumber"></span> <span class="toctext">First stage:Sensing system</span></a></li>
<li class="toclevel-2"><a href="#sensing">
<span class="tocnumber"></span> <span class="toctext">Second stage:Amplification system</span></a></li>
<ul>
<li class="toclevel-3"><a href="#5">
<span class="tocnumber"></span> <span class="toctext">DNA origami approach</span></a></li>
<li class="toclevel-3"><a href="#6">
<span class="tocnumber"></span> <span class="toctext">Flower DNA approach</span></a></li>
</li>


<section id="tabs">


</ul>
</li>
</ul>
</td></tr></table>


  <article data-title="Chain-reactive burst">
<h2 id=chain>Project goal</h2>
&nbsp;In Lipo-HANABI project, we need to develop the following two subsystems.<br><br>


i) Sensing system (First stage): liposome disruption by temperature control. <br>


ii) Amplification system (Second stage): a chain-reactive disruption of the liposomes activated by the First stage. <br><br>


<h3 id="chain">Chain-reactive burst</h3></br>
<h3 id=Flower>First stage: Sensing system </h3>
<br>
&nbsp;The purpose of First stage is to detect temperature change and release key molecules for the Second stage. This is achieved by temperature-sensitive liposomes containing &nbsp;the keys. To make the liposome, we used lipids conjugated with NIPAM polymer.<br>
We designed “chain-reactive burst” system as follows.<br>
&nbsp;This structural change of NIPAM induces stress on the surface of the liposome, and consequently disrupts them.<br>
Each liposome contains triggers and drugs inside, and aptamers for the trigger on its surface. When liposomes are destroyed, new triggers and drugs are released. To achieve liposomal burst by outside triggers, we propose the following two approaches. <br>
<div align="center">
<br>
<Img Src="http://openwetware.org/images/9/95/NIPAM%E3%83%AA%E3%83%9D%E3%81%A1%E3%82%83%E3%82%933.png">
<li> <h5>i) Bending approach</h5></li>
</div>
<li> <h5>ii) Flower micelle approach</h5></li>
<div class="caption">Fig.1 Temperature-sensitive liposome</div>  
<br>
<h3 id=sensing>Second stage: Amplification system </h3>
First, we considered a theory to disrupt liposomes by a trigger DNA signal through calculation. If a liposome is destroyed, its size becomes smaller. We estimated the free energy gap between the two liposomal states: a large liposome and a small one. And  discuss which size of liposomes is more stable.<br>
&nbsp;The purpose of Second stage is to accept the key from the First stage and release a lot of payload molecules in a chain-reaction. <br>
Please see the details (Go to <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/calcuation">Calculation</a>).<br>
&nbsp;There are two different approaches to realize the Second stage.<br>
  A) DNA Origami approach<br>
  B) Flower DNA approach<br>


<h4> i)Bending Approach</h4><br>
<h4 id=5>DNA origami approach </h4>


<Img Src="http://openwetware.org/images/f/f2/Design-bending-flow.png" Align="center" width="900px" ><br>
<div align="center">Fig.1 Process of bending approach</div><br>
<br>
Our bending approach consists of the following four steps.<br>
1.Cholesterol-conjugated DNA strands (in the rest of this document, referred to as “aptamers”) attach to the surfaces of liposomes.<br>
2. Then, DNA origami complementary to the aptamer is added as triggers.<br>
3. Triggers bind to the surfaces of liposomes and give a load on the membrane.<br>
4. Due to the load by triggers, liposomes are destroyed.<br>
<br>


<h5>a) Mechanism of bending membranes</h5>
To destroy liposomes, we focused on the mechanism the living things use to bend cell membranes. We consider that if we could make use of the mechanism of bending membranes (destabilizing membranes), it would lead to the collapse of membranes. The following three mechanisms have been proposed as of now (<A Href="http://www.ncbi.nlm.nih.gov/pubmed/19780639">Membrane-bending proteins</A>)<br>


<div class="caption-left">
&nbsp;This approach is inspired by a paper about <a Href="http://www.ncbi.nlm.nih.gov/pubmed/19780639"> Membrane-bending proteins (Prinz WA, Hinshaw JE., Crit Rev Biochem Mol Biol., 2009)</a>.
<Img Src="http://openwetware.org/images/a/ae/Designfig2.png" width="280px" height="400px">
In this approach,　we use “Origami-anchor DNA” which connects DNA Origami with liposome membrane.
<span>Fig.2 Mechanism of bending membranes</span></div>
<br>
The mechanism A is that amphipathic molecules are inserted into the cell membrane and the bending is caused. The inner hydrophobic part of the lipid bilayer has a strong adhesive power for the two leaflets. Thus, once the amphipathic molecules are inserted into one leaflet of the membrane and expand it, the other leaflet bends according to it, making its surface area smallest.<br>
<br>
The mechanism B is that the molecule attached to the membrane becomes a rigid scaffold and distort the membrane under itself, or stabilize the already bended membrane.<br>
<br>
The mechanism C is that lipid molecules are clustered in one leaflet of the membrane and the inequality of lipid quantity makes the membrane bend.<br>
<div class="c-both"></div>


Most membrane bending proteins combine the above three mechanisms.<br>
A lot of DNA origamis are adsorbed on the surface of liposomes by using Origami-anchor DNA. DNA origami is supposed to be a stiff, straight board compared with liposome membrane, and as a result, liposome surface gets bending stress. At certain level of the absorbance, liposomes will burst. Also, DNA origamis on the surface repel each other because of negative charges on DNA backbones. This effect may add more stress on the membrane.<br>
In addition, a theory that protein crowding causes the bending of cell membranes ( <A Href="http://www.ncbi.nlm.nih.gov/pubmed/22902598">Membrane bending by protein- protein crowding</A>) has recently been suggested. This mechanism is that the collision of membrane proteins produces lateral pressure on membranes and distorts them.<br>
<br>
Due to the above reasons, the efficient design for destabilizing membranes is the structures that :<br>
<ur><li>have rigid scaffolds</li>
<li>have large surface areas to maximize the effect of the scaffold on the membrane</li>
<li>produce a large pressure by collisions</li></ur>
<br>
<h5>b) Rigid scaffolds</h5>
To make rigid scaffolds, we took note of DNA origami, because DNA origami is a method for making rigid structures of any shape. Moreover, we adopted a 2D structure to make the surface area largest.<br>


<br>
<div align="center">
We also designed rectangle and triangle to make the pressure of the collision highest.<br>
<Img Src="http://openwetware.org/images/c/c5/%E8%86%9C%E3%80%80%E5%8F%8D%E7%99%BAdfhr.png">
<Img Src="http://openwetware.org/images/e/e7/Design-outside-fig3.png">
<br>
<div align="center">Fig.3 Rectangle origami and triangle origami</div><br>
We suppose that rectangle and triangle structures are most effective for the following reasons. <br>
Rectangle is expected to work as one scaffold in itself; triangle (the most efficient figure that covers a sphere) structures, to gather and work as one big rigid scaffold.<br>
<br>
The design of our rectangular DNA origami is as below.<br>
<Img Src="http://openwetware.org/images/b/b1/Design-outside-fig4.png">
<div align="center">Fig.4 Rectangular origami</div>
<br>
<div class="caption-right">
<Img Src="http://openwetware.org/images/a/a7/Lipo5.png" ><span>Fig.5 DNA origami designed by caDNAno</span>
</div>
</div>
We used <A Href="http://cadnano.org/">caDNAno2</A> for our DNA origami design.<br>
<div class="caption">Fig.2 Stress on liposome membrane</div>
The DNA origami has a rectangle shape of 67.6nm (26 helixes) by 127 nm (374 bases).<br>
We cut out a smaller rectangle of 10 helixes by 161 bases at one edge of this origami, so that we could distinguish the two sides during AFM (Atomic Force Microscope) observation.<br>
Besides, to destabilize the membrane by inserting this origami, we designed 141 staples at the center of the origami to hybridize with aptamers (These aptamers give our origami amphipathicity), and enabled it to insert into the membrane.
<br>
<br>
<div class="c-both"></div>
&nbsp;From the reference, we learned that efficient structure design for destabilizing membranes should have the following properties: <br>
To sum up, the aptamer not only connects DNA origami and liposomes but also inserts into the membrane and destabilizes it.<br>
<ur><li>Having rigid scaffolds</li>
<li>Having large surface areas to maximize the effect of the scaffold on the membrane</li></ur>


<Img Src="http://openwetware.org/images/c/c5/Outsidefig5.png">
<Design of DNA origami><br>
<div align="center">Fig.6 Unstable liposome</div>
&nbsp;DNA origami is known as a designable rigid structure made of DNA. We use DNA origami to make the rigid scaffolds. In order to meet the requirements, we designed a 2D rectangular DNA origami.<br>
<br>  
<h4>ii)Flower micelle approach</h4><br>
<Img Src="http://openwetware.org/images/8/8f/Design-flower-flow.png" Align="center" width="900px" ><br>
<div align="center">Fig.7 Process of flower micelle approach</div><br>


<div align="center">
<Img Src="http://openwetware.org/images/4/45/Outsidefig8.png">
</div>
<div class="caption">Fig.3 Rectangular origami</div>
<br>
<div class="caption-right">
<div class="caption-right">
<Img Src="http://openwetware.org/images/6/6f/Design-flowermicelle.png" style="width:425px;"><span>Fig.8 Flower micelle method</span></div>
<Img Src="http://openwetware.org/images/a/a7/Lipo5.png" style="padding-left:10mm"><span>Fig.4 DNA origami designed by caDNAno</span>
There is a method called flower micelles for collapsing liposomes. <br>
</div>
In this method, we cover the surfaces of liposomes with many copolymer rings. The rings can be distorted by heating, place some stress on the liposomes, and collapse them.<br>
&nbsp;We use <a href="http://cadnano.org/">caDNAno2</a> for our DNA origami design.
We tried to collapse liposomes by applying this mechanism of flower micelles.<br>
The size of DNA origami is 67.6nm (26 helixes) in width and 127 nm (374 bases) in height.
<div class="c-both"></div>
We cut out a smaller rectangle of 10 helixes (161 bases) at one of the corners,
so that we could distinguish the two sides with AFM (Atomic Force Microscope) observation.  
Also, we put 141 staples sticking out from the bottom face of the origami.
Those staples hybridize with cholesterol-modified Origami-anchor DNA, which has high affinity with lipid membrane.<br>
<br>
<br>
1. First, we mix aptamers (the same strands as used in i) Bending approach), loop strands, and liposomes.<br>
<div align="center">
Each of the loop strands is designed to have two complementary parts to aptamers at its both ends. So when it binds to the aptamers at the both ends, the middle part remains single-stranded and becomes a loop. <br>
<Img Src="http://openwetware.org/images/a/a0/Outsidefig5rg.png"　width="450px" height="350px">
As an aptamer is cholesterol-conjugated and has high affinity for a liposome, it floats on a liposome and enables the aptamer-loop strand complex attach to the liposome. In other words, a loop strand hybridizes with a liposome via two aptamers.<br>
</div>
<Img Src="http://openwetware.org/images/a/aa/Flower2.png">  
<div class="caption">Fig.5 Unstable liposome</div>
<br>
<br><br>
<div align="center">Fig.9 Make loops on the surface of a liposome</div>
<h4 id=6>Flower DNA approach</h4>
<br>
&nbsp;This approach is inspired by a paper about <a href="http://pubs.acs.org/doi/ipdf/10.1021/jp104711q">Polymer Flower-micelle (Yukio Tominaga, Mari Mizuse, Akihito Hashidzume, Yotaro Morishima and Takahiro Sato, J. Phys. Chem. B, 2010)</a>.
2. Next, we add a trigger strand corresponding (complementary) to the loop strand on the liposome. The trigger strand hybridizes with the loop part, making it change to be straight.<br>
To adapt the Polymer Flower-micelle to our project, the followings are required.<br><br>
<br>
<ur><li>Embedding a lot of cholesterol-modified ss DNA on the liposome surface</li>
3. The double-stranded part keeps straight (though it was originally a loop part), because the trigger strand is designed to be shorter than its persistence length.<br>
<li>Adding another ssDNA (complementary to the above DNA) which induces a structural change　by DNA hybridization</li>
<img src="http://openwetware.org/images/0/03/Flower3.png"><br>
<li>The induced structural change on the DNA results in disruption of the liposome</li>
<div align="center">Fig.10 How to straighten loop</div>
4.In this process, some stress is placed on the liposome, and it is collapsed.<br>
<Img Src="http://openwetware.org/images/3/3b/Flower4.png"><br>
<div align="center">Fig.11 Liposomal burst</div>
<br>
<br>
It is considered if some triggers are kept inside a liposome, and the liposomal membrane is collapsed by the above i) and ii) methods from the outside, it would be much easy to trigger "Chain-reactive burst", because the released triggers serve as new triggers for neighbor liposomes. <br>
&nbsp;At first, we designed “Flower-anchor DNA”, which is a couple of ss DNAs both having cholesterol modified groups (Fig.6): Flower-anchor1 is 10nt ss DNA and Flower-anchor2 is 50nt ss DNA. Both are cholesterol-modified at their 3’ ends. <br>
&nbsp;In addition, the 5’ end of the Flower-anchor2 is complementary to Flower-anchor1. When they hybridize, the rest 40nt of Flower-anchor2 remains single-stranded.<br><br>
<div align="center">
<Img Src="http://openwetware.org/images/3/3d/Flower-newfg.png" width="450px" height="350px" ></div><br>
<div class="caption">Fig.6 Liposome with Flower-anchor DNA</div>
<br>
<br>
We designed the DNA sequences for this approach by <A Href="http://www.dna.caltech.edu/DNAdesign/">DNA design</A>, software for designing DNA sequences. <br>
&nbsp;The key DNA released from stage 1 liposome is complementary to this single-stranded part. When the key hybridizes on it, a double-stranded section is formed. The length of the section is shorter than its persistence length; therefore it works as a rigid strut. The strut is anchored on the liposome at both ends, thus it extends the membrane. As a consequence, this may lead to drastic conformational change of the liposome, namely, disruption. <br><br>
We arranged three kinds of loop strands. <br>
<div align="center">
Each loop strand has a 40nt, 20nt, or 10nt loop part (shown below in black and blue), which becomes a loop after the hybridization of the whole loop strand with aptamers.<br>
<img src="http://openwetware.org/images/6/65/Flower3new8.png" width="70%" hight="800"><br>
The blue part of a loop strand is complementary to a corresponding trigger strand (also shown in blue). So a loop strand and a trigger strand are expected to hybridize with each other, place some stress on a liposome, and collapse it. <br>
<div class="caption">Fig.7 Process of flower DNA approach</div><br><br>
The red part of a loop strand is complementary to an aptamer (shown in red). Cooperating with aptamers, it enables the whole loop strand to attach to the surface of a liposome. <br>
<Img Src="http://openwetware.org/images/1/17/Flor4.png" width="70%" hight="800" ><br>
Aptamers are the same strands as those used in i)Bending approach.<br>
<div class="caption">Fig.8 How to disrupt a liposome</div>
<font size="-2">
      </article>
Aptamer DNA<br>
<font color="red">CCAGAAGACG</font> -cholesterol<br>
40nt loop DNA<br>
<font color="red">CGTCTTCTGG</font>TTTTTTTTTT<font color="blue">GCGAACCACGGTTCCCAGCGTGACCTTCATGCTTAAGTTT</font><font color="red">CGTCTTCTGG</font><br>
Trigger DNA for 40 nt loop DNA<br>
<font color="blue">AAACTTAAGCATGAAGGTCACGCTGGGAACCGTGGTTCGC</font><br>
20nt loop DNA<br>
<font color="red">CGTCTTCTGG</font>TTTTTTTTTTTT<font color="blue">CATAACATGAGGCGCCGT</font><font color="red">CGTCTTCTGG</font><br>
Trigger DNA for 20 nt loop DNA<br>
<font color="blue">ACGGCGCCTCATGTTATGAA</font><br>
10nt loop DNA<br>
<font color="red">CGTCTTCTGG</font>TTTTTTTTTT<font color="blue">CTGTAACTAA</font><font color="red">CGTCTTCTGG</font><br>
Trigger DNA for 10 nt loop DNA<br>
<font color="blue">TTAGTTACAG</font><br>
</font>
 
        </article>
 
 
 
</section>
</section>
<!-- /***** </div> ****/ -->
<!-- /***** </div> ****/ -->
    
    
Line 210: Line 174:
</body>
</body>
</html>
</html>


{{Biomod/2013/Sendai/sandbox/template2}}
{{Biomod/2013/Sendai/sandbox/template2}}

Latest revision as of 22:54, 26 October 2013

<html> <head> <style>


/********************** Hide MediaWiki and init CSS, overwrite by bootstrap.css バルス**********************/

body{ 

background:none;

} html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, embed, figure, figcaption, footer, header, hgroup, menu, nav, output, ruby, section, summary, time, mark, audio, video{ 

margin:0;
padding:0;
/* font-size:100%; */
 border:0;
outline:0;

} a, a:link, a:visited, a:hover, a:active{ 

text-decoration:none

}

/*訪れたリンクを白くするよ*/ .whiteSendai:visited{ 

color:#FFFFFF!important;

}

/*左詰め、真ん中、右詰め*/ .leftSendai { text-align: left; } .centerSendai { text-align: center; } .rightSendai { text-align: right; }


.firstHeading { 

display:none;

}

  1. content{
border-style:none;
margin:0;
padding:0;

}

  1. globalWrapper{
font-size:100%;

}

  1. contentSub{
display:none;

}

  1. column-one{
display:none;

}

  1. footer{
display:none;

}

  1. globalWrapper{
font-size:100%;

}

  1. bodyContent h1, #bodyContent h2{
 margin-top: 20px;
 margin-bottom: 10px;

}


  1. bodyContent h3{
 margin-top: 20px;
 margin-bottom: 10px;
 border-bottom-width: medium;
 border-bottom-style: solid;
 border-bottom-color: gray;

}

  1. bodyContent h4{
 margin-top: 20px;
 margin-bottom: 10px;
 border-bottom-width: thin;
 border-bottom-style: solid;
 border-bottom-color: gray;

}

  1. bodyContent h5, #bodyContent h6{
 margin-top: 10px;
 margin-bottom: 10px;

/**** border-bottom-width: thin; 

 border-bottom-style: solid;
 border-bottom-color: gray;
        • /

}

/********************************* Hide MediaWiki end *********************************/


/* Structure */ html{ background: #eee; } body { 

 padding: 0px;
 background: #fff;
 color: #333;
 margin: 0 auto;
 max-width: 900px;
 font: 1em/1.5 "Helvetica Neue", Helvetica, Arial, sans-serif;
 }

a { 

 color: #105672;

}

header {/****position: fixed; ****/ 

       /******width: 100%;****/
       height: 90px;
       z-index: 1;

background: #F17F25; 

        padding:0.01em 0.5em 1.5em ;

color: #fff; line-height: 1;

}

header h1{ margin-bottom: 0; }

header h1 span{ display: inline; color: rgba(255,255,255,.4); }

header span{ display: block; color: rgba(255,255,255,.2); font-weight: 300; margin-bottom: 1.6em }

header nav{ float: right; text-align: right } header nav div{ font-size: .8em; } header nav div a { font-weight: 300; padding: .3em .5em } header nav a{ color: #fff; display: inline-block; padding: .3em .8em }

header nav a:hover, header nav a:focus{ color: rgba(255,255,255,.6) }


[role=main]{ padding:1.5em 3em; } article{ padding: 1em 0; text-align: justify; text-justify: inter-ideograph;

}


footer{ background: #333; color: #fff; padding: 1em 3em; 

       clear: both;    /***2段組みの左右のfloatを解除***/

}

/* Typography */

p{ font: 1em/1.5 Palatino, "Palatino Linotype", Georgia, Times, "Times New Roman", serif; }

p.sukima{ 

       font-size: 150%;
       font-weight: normal;
       font-family: Helvetica;
       background: #bbb;
       padding-left: 1.2em;

}

img{ max-width: 100%; /***** height: auto; *****/ }


blockquote{ float: left; margin: 1em 3em; } blockquote p{ font-size: 1.4em; line-height: 1.2; font-weight: 700; font-style:italic; } a{ font: 700 1em/1.5 "Helvetica Neue", Helvetica, Arial, sans-serif; text-decoration: none } a:hover, a:focus{ color: #000; } a:active{ position: relative; top:1px; }

ol{margin: 1em 0 1em 0; padding-left: 2em; } li{ margin: 0; }

/* Tabs */

  1. tabs

{ /*****position:fixed;****/ 

      width: 900px;

}

.js-on #tabs article { display:none }

  1. tabs, #tabs nav a.active{

background: #FFF; color: #111; }

  1. tabs nav

{ position: relative; overflow: hidden; display: table; background: #bbb; }


  1. tabs nav a

{ width:900px; display:table-cell; padding:1em; text-align:center; color: #333; }

  1. tabs nav a:hover,#tabs nav a:focus

{ background:#eee }

  1. tabs article

{ padding:2em; }


.js-on #tabs article.active { display:block; }

  1. tabs #mobiles{

display:none; border-radius: 0; }

  1. tabs #mobiles a, #tabs #mobiles a:first-child, #tabs #mobiles a:last-child{

width:300px; border-radius: 0; }


/* Media queries */ @media screen and (min-width:900px) { body{font-size: 1.1em;} }

@media screen and (max-width:600px) { #tabs nav{ display: none; position: relative; } #tabs #mobiles{ display:block; } #tabs article { display:block; } } @media screen and (max-width:480px) { blockquote{ float: none; }

header nav a{ padding:.7em .8em } header nav{ float: none; margin: -.5em -3em 0; background: #000; overflow: hidden; text-align: left } header nav a{ border-right: 1px solid #222 } [role=main]{ padding:1.5em 2em; } header nav div{ display: none; }

}

/*column content*/

  1. content-right {

width:48%; /***段落の横幅***/ float:right; /***右に寄せる（他の要素を左に回り込ませる)***/ margin: 10px; }

  1. content-left {

width:47%; /***サイドの横幅***/ float:left; /***左に寄せる***/ margin: 10px; }

/*****キャプションレフト*****/

div.caption-left{ float: left; padding: 0 5px 5px 5px; }

.caption-left span{ display: block; text-align: center; 

       font-size: smaller;
       font-weight: bold;

}

div.clear{ clear: both; margin: 0 0 10px 0; }

/*****キャプションライト*****/

div.caption-right{ float: right; padding: 0 5px 5px 5px; }

.caption-right span{ display: block; text-align: center; 

       font-size: smaller;
       font-weight: bold;

}

div.clear{ clear: both; margin: 0 0 10px 0; } 

/***floatの影響を絶つ。<div class="c-both"></div> のように使う***/

.c-both { clear: both; }

div.title{ 

        font-style: normal;
        font-weight: bold;
        font-size: 70px;
        line-height: 70px;
        font-family: Helvetica;

}

div.caption{ 

       text-align: center;
       font-size: smaller;
       font-weight: bold;

}

div.captiontable{ 

       font-size: smaller;
       font-weight: bold;

}

/*topに戻る*/

  1. ttop {position:fixed;
      bottom:140px;
      left:auto;margin:0 0 0 905px; /* マージン：上 右 下 左 */
      width:100px;
      height:390px;
      background:url(http://openwetware.org/images/f/f2/%E5%90%8D%E7%A7%B0%E6%9C%AA%E8%A8%AD%E5%AE%9A-1.png) no-repeat left bottom;}

/* IE6以下用、アスタリスクハックでググれ */

  • html #ttop {margin:0 0 -390px 0;
             position:relative;bottom:490px; /* 上で設定した ttopの高さ390px＋下100px */
             left:960px;}
  1. ttop:hover {background:url(http://openwetware.org/images/b/b9/Top2.png) no-repeat left bottom;/* 画像の高さによって適当に調整 */
            }

a.page_top {display:block;width:100px;height:390px;}


</style> </head> </html> <html xmlns="http://www.w3.org/1999/xhtml"> <head> 

   <title>Biomod2013 Sendai ver2.0</title>
   <meta name="viewport" content="width=device-width,initial-scale=1">
   
   <style type="text/css">
   h1{color: white;}
   </style>

</head>

<body> <!-- <div style="max-width:900px; position:fixed;">****/ --> 

   <header>

        <nav>      
          <div>

<!-- 

               <a href="#"  class="whiteSendai">Blog</a> 
               <a href="#"  class="whiteSendai">Twitter</a>
               <a href="#"  class="whiteSendai">Facebook</a>

--> <br><br> 

           </div>
          <a href="http://openwetware.org/wiki/Biomod/2013/Sendai" class="whiteSendai">Top</a> 
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/project" class="whiteSendai">Project</a>
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/design" class="whiteSendai">Design</a> 
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/calcuation" class="whiteSendai">Calculation</a>
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/experiment" class="whiteSendai">Experiment</a>

<a href="http://openwetware.org/wiki/Biomod/2013" class="whiteSendai" style="float:right;"><img src="http://openwetware.org/images/6/6e/Biomod-logo.jpg" 

                                              width="75" height="75" alt="Biomod2013" border="0"></a><br>
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/protocol" class="whiteSendai">Protocol</a>   
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/future" class="whiteSendai">Future</a> 
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/member" class="whiteSendai">Member</a>
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/sponsor" class="whiteSendai">Sponsor</a>
           </nav>
            <a href="http://openwetware.org/wiki/Biomod/2013/Sendai"><h1 style="color:white;" ><b>Biomod<span>2013<br>&emsp; Team</span>Sendai</b></h1></a>

</header>

<div id="ttop"> <a href="#top" class="page_top" onfocus="this.blur();" onclick="scrollTo(0,0); return false;" title="Top"></a></div> 

<section role="main">
       <article>
        <h2>Design</h2>

<table id="toc" class="toc" summary="Contents"><tr><td><div id="toctitle"><h2>Contents</h2></div> <ul> <li class="toclevel-1"><a href="#chain"> <span class="tocnumber"></span> <span class="toctext">Project goal</span></a></li> <ul> <li class="toclevel-2"><a href="#Flower"> <span class="tocnumber"></span> <span class="toctext">First stage:Sensing system</span></a></li> <li class="toclevel-2"><a href="#sensing"> <span class="tocnumber"></span> <span class="toctext">Second stage:Amplification system</span></a></li> <ul> <li class="toclevel-3"><a href="#5"> <span class="tocnumber"></span> <span class="toctext">DNA origami approach</span></a></li> <li class="toclevel-3"><a href="#6"> <span class="tocnumber"></span> <span class="toctext">Flower DNA approach</span></a></li> </li>


</ul> </li> </ul> </td></tr></table>

<h2 id=chain>Project goal</h2> &nbsp;In Lipo-HANABI project, we need to develop the following two subsystems.<br><br>

i) Sensing system (First stage): liposome disruption by temperature control. <br>

ii) Amplification system (Second stage): a chain-reactive disruption of the liposomes activated by the First stage. <br><br>

<h3 id=Flower>First stage: Sensing system </h3> &nbsp;The purpose of First stage is to detect temperature change and release key molecules for the Second stage. This is achieved by temperature-sensitive liposomes containing &nbsp;the keys. To make the liposome, we used lipids conjugated with NIPAM polymer.<br> &nbsp;This structural change of NIPAM induces stress on the surface of the liposome, and consequently disrupts them.<br> <div align="center"> <Img Src="http://openwetware.org/images/9/95/NIPAM%E3%83%AA%E3%83%9D%E3%81%A1%E3%82%83%E3%82%933.png"> </div> <div class="caption">Fig.1 Temperature-sensitive liposome</div> <h3 id=sensing>Second stage: Amplification system </h3> &nbsp;The purpose of Second stage is to accept the key from the First stage and release a lot of payload molecules in a chain-reaction. <br> &nbsp;There are two different approaches to realize the Second stage.<br> 

  A) DNA Origami approach<br>
  B) Flower DNA approach<br>

<h4 id=5>DNA origami approach </h4>


&nbsp;This approach is inspired by a paper about <a Href="http://www.ncbi.nlm.nih.gov/pubmed/19780639"> Membrane-bending proteins (Prinz WA, Hinshaw JE., Crit Rev Biochem Mol Biol., 2009)</a>. In this approach,　we use “Origami-anchor DNA” which connects DNA Origami with liposome membrane.

A lot of DNA origamis are adsorbed on the surface of liposomes by using Origami-anchor DNA. DNA origami is supposed to be a stiff, straight board compared with liposome membrane, and as a result, liposome surface gets bending stress. At certain level of the absorbance, liposomes will burst. Also, DNA origamis on the surface repel each other because of negative charges on DNA backbones. This effect may add more stress on the membrane.<br>

<div align="center"> <Img Src="http://openwetware.org/images/c/c5/%E8%86%9C%E3%80%80%E5%8F%8D%E7%99%BAdfhr.png"> </div> <div class="caption">Fig.2 Stress on liposome membrane</div> <br> &nbsp;From the reference, we learned that efficient structure design for destabilizing membranes should have the following properties: <br> <ur><li>Having rigid scaffolds</li> <li>Having large surface areas to maximize the effect of the scaffold on the membrane</li></ur>

<Design of DNA origami><br> &nbsp;DNA origami is known as a designable rigid structure made of DNA. We use DNA origami to make the rigid scaffolds. In order to meet the requirements, we designed a 2D rectangular DNA origami.<br>

<div align="center"> <Img Src="http://openwetware.org/images/4/45/Outsidefig8.png"> </div> <div class="caption">Fig.3 Rectangular origami</div> <br> <div class="caption-right"> 

<Img Src="http://openwetware.org/images/a/a7/Lipo5.png" style="padding-left:10mm"><span>Fig.4 DNA origami designed by caDNAno</span>

</div> &nbsp;We use <a href="http://cadnano.org/">caDNAno2</a> for our DNA origami design. The size of DNA origami is 67.6nm (26 helixes) in width and 127 nm (374 bases) in height. We cut out a smaller rectangle of 10 helixes (161 bases) at one of the corners, so that we could distinguish the two sides with AFM (Atomic Force Microscope) observation. Also, we put 141 staples sticking out from the bottom face of the origami. Those staples hybridize with cholesterol-modified Origami-anchor DNA, which has high affinity with lipid membrane.<br> <br> <div align="center"> <Img Src="http://openwetware.org/images/a/a0/Outsidefig5rg.png"　width="450px" height="350px"> </div> <div class="caption">Fig.5 Unstable liposome</div> <br><br> <h4 id=6>Flower DNA approach</h4> &nbsp;This approach is inspired by a paper about <a href="http://pubs.acs.org/doi/ipdf/10.1021/jp104711q">Polymer Flower-micelle (Yukio Tominaga, Mari Mizuse, Akihito Hashidzume, Yotaro Morishima and Takahiro Sato, J. Phys. Chem. B, 2010)</a>. To adapt the Polymer Flower-micelle to our project, the followings are required.<br><br> <ur><li>Embedding a lot of cholesterol-modified ss DNA on the liposome surface</li> <li>Adding another ssDNA (complementary to the above DNA) which induces a structural change　by DNA hybridization</li> <li>The induced structural change on the DNA results in disruption of the liposome</li> <br> &nbsp;At first, we designed “Flower-anchor DNA”, which is a couple of ss DNAs both having cholesterol modified groups (Fig.6): Flower-anchor1 is 10nt ss DNA and Flower-anchor2 is 50nt ss DNA. Both are cholesterol-modified at their 3’ ends. <br> &nbsp;In addition, the 5’ end of the Flower-anchor2 is complementary to Flower-anchor1. When they hybridize, the rest 40nt of Flower-anchor2 remains single-stranded.<br><br> <div align="center"> <Img Src="http://openwetware.org/images/3/3d/Flower-newfg.png" width="450px" height="350px" ></div><br> <div class="caption">Fig.6 Liposome with Flower-anchor DNA</div> <br> &nbsp;The key DNA released from stage 1 liposome is complementary to this single-stranded part. When the key hybridizes on it, a double-stranded section is formed. The length of the section is shorter than its persistence length; therefore it works as a rigid strut. The strut is anchored on the liposome at both ends, thus it extends the membrane. As a consequence, this may lead to drastic conformational change of the liposome, namely, disruption. <br><br> <div align="center"> <img src="http://openwetware.org/images/6/65/Flower3new8.png" width="70%" hight="800"><br> <div class="caption">Fig.7 Process of flower DNA approach</div><br><br> <Img Src="http://openwetware.org/images/1/17/Flor4.png" width="70%" hight="800" ><br> <div class="caption">Fig.8 How to disrupt a liposome</div> 

      </article>

</section> <!-- /***** </div> ****/ --> 


   <footer>
       <p>&copy; Copyright Biomod 2013 Team Sendai
               <a href="http://www.molbot.mech.tohoku.ac.jp/index.html">

　　　　　　　　　　　　　　　　　　<img src="http://openwetware.org/images/3/36/Murata-nomura-logo.png" 

                                     width="180" height="50" alt="Molcular Robotics Lab" border="0" align="right">

　　　　　　　　 </a> 　　　　 </p> 

       <p>E-MAIL:
           <a href="mailto:biomod.teamsendai.2012@gmail.com">biomod.teamsendai.2012@gmail.com
           </a>
       </p>
       <br>
       <a href="?action=edit" align="center"><p>edit</p></a>
   </footer>

</body> </html>


<html> <head> 

       <script type="text/javascript">
     function tabs(a,g,j){document.body.className="js-on";var g=a.getElementsByTagName(g),d=[],c;this.active;this.total=g.length;this.container=a;e=a.insertBefore(document.createElement("nav"),g[0]),change=function(f){if(typeof this.active!=="undefined"){d[this.active].className=g[this.active].className=""}d[f].className=g[f].className="active";this.active=f},clickEvent=function(h,f){h.onclick=function(){change(f);return false}};for(var b=0;b<g.length;b++){d[b]=e.appendChild(document.createElement("a"));d[b].href="#";c=[g[b].getAttribute("data-title"),g[b].getElementsByTagName(j)[0]];d[b].innerHTML=c[0]!==null?c[0]:c[1]?c[1]["innerText"||"textContent"]:b+1;new clickEvent(d[b],b)}change(0)}tabs.prototype.change=function(b){change(b-1)};tabs.prototype.next=function(b){active===this.total-1?change(0):change(active+1)};tabs.prototype.prev=function(b){active===0?change(this.total-1):change(active-1)};tabs.prototype.responsive=function(d,c){nav=document.createElement("nav");nav.id="mobiles";nav.innerHTML='<a href="#" onclick="'+d+'.prev(); return false">'+c.prev+'</a><a href="#" onclick="'+d+'.next(); return false">'+c.next+"</a>";this.container.insertBefore(nav,this.container.firstChild);return this};
       </script>
       <script type="text/javascript">

var myTabs = new tabs(document.getElementById("tabs"), "article", "h2").responsive("myTabs", { prev: "Previous", next: "Next" }); </script> </head> </html>

Retrieved from "https://openwetware.org/mediawiki/index.php?title=Biomod/2013/Sendai/design&oldid=750348"