Biomod/2013/Sendai/design

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 227: Line 227:
<div align="center">Fig.9 Make loops on the surface of the liposomes</div>
<div align="center">Fig.9 Make loops on the surface of the liposomes</div>
<br>
<br>
-
2. Next, we add complementary trigger strand to the loop strand. The trigger strand hybridizes with the loop strand.<br>
+
2. Next, we add complementary trigger strands to the loop strands. The trigger strands hybridize with the loop strands.<br>
<br>
<br>
3. And then the strands keep straight, because we designed the trigger strand shorter than its persistence length.<br>
3. And then the strands keep straight, because we designed the trigger strand shorter than its persistence length.<br>

Revision as of 10:14, 31 August 2013

Biomod2013 Sendai ver2.0

Biomod2013
  Team
Sendai

Design

Egg-type initiator


example-tab2
Fig.1 process of Egg-type initiator


Egg-type initiator consists of two layers.

The first layer: “alginate gel membrane”

The alginate gel membrane has a solution phase inside them, and resembles artificial salmon caviars (JINKOH-IKURA in Japanese).

The second layer: “temperature-sensitive liposomes”

The temperature-sensitive liposomes contain PNIPAM lipids in their membrane. Temperature shift causing hydrophobicity change of the PNIPAM induces collapse of the liposomes (See “Characters of the PNIPAM molecular” ). The temperature-sensitive liposomes encapsulate a chelate compound (EGTA) and DNAs.

The two layers realize a dual disruption system as follows (Fig.1). The first is “liposome disruption” by increasing temperature. The second is “disruption of alginate membrane” by chelating reagent (EGTA) of calcium released from the liposomes disrupted. This system enables to release many trigger DNAs at a limited point.

1.The alginate gel membrane encapsulates many temperature-sensitive liposomes.
Please refer following link( pdf ).
2. Warming the temperature-sensitive liposomes from room temperature to over 32 ºC causes disruption of the liposomes.
3. The liposome disruption release DNAs and EGTA (and urea) which chelate calcium. Lowering calcium concentration starts to melt the alginate gel membrane. During this process, DNA origami is formed when urea is added.
4. As a result of the melting, trigger DNAs (DNA origami structure or DNA strands for the flower micelle approach (See design: Chain-reactive burst )) are released from the melted alginate membrane.

An application to DNA origami formation using the dual disruption system

This dual structure enables to spontaneous formation of DNA origami through environmental stimulation. Three components, Urea (a denature reagent of DNA nanostructure) and materials of DNA origami and EGTA, can be encapsulated in liposomes. It takes times (several hours) to melt the gel membrane by EGTA released from the temperature-sensitive liposomes. Because small molecules can diffuse in alginate gels, urea inside alginate is expected to be gradually diluted during the melting. DNA origami could be formed through the dilution of urea (See “DNA origami formation through urea dilution” ).

※Principle of this system
Alginate gels
Alginate is widely used in foods additives and drug stabilizers.
Sodium alginate is the neutral salt which an alginate carboxyl group coupled with a Na+. It dissolves in water well and becomes water solution with the high viscosity. If Ca2+ is added to the sodium alginate solution, ion bridging happens instantly and gelation happen. And If Chelating reagent (for example EDTA, EGTA) is added to alginate hydrogel, Ca2+ is robbed and gel collapse.

Fig.2 A image about Gelation and Solation of alginate gel

Characters of the PNIPAM molecular
Hydrophobicity of NIPAM varies at temperatures. NIPAM is hydrophilic at less than 32 ºC, but it become hydrophobic and shrinks at > 32 ºC. Therefore, liposomes containing a modified NIPAM (poly(NIPAM-co-AA-co-ODA) in their membranes become unstable at high temperature (temperature-sensitive liposomes). Consequently, increasing temperature disrupt the liposomes.
Reference( pdf)

Fig.3 A schematic image how liposome containing PNIPAM disrupt at high temperature is shown.

DNA origami formation through urea dilution
Polarity of water molecular becomes weak in the presence of urea. Thus, urea interrupts the hydrogen bond of DNA bases. For the reason, the melting point of DNA hybridization decreases. Thus, gradually decreasing the concentration of urea enables to form DNA origami structure under isothermal condition.

Fig.4 A image about denaturation by urea

Chain-reactive burst



We designed “chain-reactive burst” system as follows.
Each liposome contains triggers and drugs inside, and aptamers for the trigger on its surface. When liposomes are destroyed, new triggers and drugs are released. To achieve liposomal burst by outside triggers, we propose the following two approaches.

  • i) Bending approach
  • ii) Flower micelle approach

  • First, we considered a theory to disrupt liposomes by a trigger DNA signal through calculation. If a liposome is destroyed, its size becomes smaller. We estimated the free energy gap between the two liposomal states: a large liposome and a small one. And discuss which size of liposomes is more stable.
    Please see the details (Go to Calculation).

    i)Bending Approach



    Fig.1 Process of bending approach


    Our bending approach consists of the following four steps.
    1.Cholesterol-conjugated DNA strands (in the rest of this document, referred to as “aptamer”) attaches to the surfaces of liposomes.
    2. Then, DNA origami complementary to the aptamer is added as triggers.
    3. Triggers bind to the surfaces of liposomes and give a load on the membrane.
    4. Due to the load by triggers, liposomes are destroyed.

    a) Mechanism of bending membranes
    To destroy liposomes, we focused on the mechanism the living things use to bend cell membranes. We consider that if we could make use of the mechanism of bending membranes (destabilizing membranes), it would lead to the collapse of membranes. The following three mechanisms have been proposed as of now (Membrane-bending proteins)
    Fig.2 Mechanism of bending membranes

    The mechanism A is that amphipathic molecules are inserted into the cell membrane and the bending is caused. The inner hydrophobic part of the lipid bilayer has a strong adhesive power for the two leaflets. Thus, once the amphipathic molecules are inserted into one leaflet of the membrane and expand it, the other leaflet bends according to it, making its surface area smallest.

    The mechanism B is that the molecule attached to the membrane becomes a rigid scaffold and distort the membrane under itself, or stabilize the already bended membrane.

    The mechanism C is that lipid molecules are clustered in one leaflet of the membrane and the inequality of lipid quantity makes the membrane bend.
    Most membrane bending proteins combine the above three mechanisms.
    In addition, a theory that protein crowding causes the bending of cell membranes ( Membrane bending by protein- protein crowding) has recently been suggested. This mechanism is that the collision of membrane proteins produces lateral pressure on membranes and distorts them.

    Due to the above reasons, the efficient design for destabilizing membranes is the structures that :
  • have rigid scaffolds
  • have large surface areas to maximize the effect of the scaffold on the membrane
  • produce a large pressure by collisions

  • b) Rigid scaffolds
    To make rigid scaffolds, we took note of DNA origami, because DNA origami is a method for making rigid structures of any shape. Moreover, we adopted a 2D structure to make the surface area largest.

    We also designed rectangle and triangle to make the pressure of the collision highest.

    Fig.3 Rectangle origami and triangle origami

    We suppose that rectangle and triangle structures are most effective for the following reasons.
    Rectangle is expected to work as one scaffold in itself; triangle (the most efficient figure that covers a sphere) structures, to gather and work as one big rigid scaffold.

    The design of our rectangular DNA origami is as below.
    Fig.4 Rectangular origami

    Fig.5 DNA origami designed by caDNAno
    We used caDNAno for our DNA origami design.
    The DNA origami has a rectangle shape of 67.6nm (26 helixes) by 127 nm (374 bases).
    We cut out a smaller rectangle of 10 helixes by 161 bases at one edge of this origami, so that we could distinguish the two sides during AFM (Atomic Force Microscope) observation.
    Besides, to destabilize the membrane by inserting this origami, we designed 141 staples at the center of the origami to hybridize with aptamers (These aptamers give our origami amphipathicity), and enabled it to insert into the membrane.
    To sum up, the aptamer not only connects DNA origami and liposomes but also inserts into the membrane and destabilizes it.
    Fig.6 Unstable liposome

    ii)Flower micelle approach



    Fig.7 Process of flower micelle approach

    Fig.8 Flower micelle method
    There is a method called flower micelles for collapsing liposomes.
    In this method, we cover the surface of the micelles with many copolymer rings, heat and distort the rings, and produce pressure on the micelle and collapse them.
    We tried to collapse liposomes by applying the basis of flower micelles.

    1. First, we mix aptamers (the same strand as used in i) Bending approach), loop strands, and liposomes.
    The loop strand is designed to have two complementary parts to the aptamers at its both ends. So when it binds to the aptamers, it is expected to make a loop between its both ends.
    The complex of the aptamers and loop strand floats on the surface of the liposomes.

    Fig.9 Make loops on the surface of the liposomes

    2. Next, we add complementary trigger strands to the loop strands. The trigger strands hybridize with the loop strands.

    3. And then the strands keep straight, because we designed the trigger strand shorter than its persistence length.

    Fig.10 How to straighten loop
    4.This process gives pressure on the liposome and collapses them.

    Fig.11 Liposome burst

    We consider if some triggers are kept inside the liposomes and the liposomal membrane is broken by the above i) and ii) methods from the outside, it would be much easy to begin the chain reaction.

    We designed the DNA sequence for this approach by DNA design, software for designing DNA sequences.
    We arranged three kinds of DNA strands that hybridize with the surface of liposomes via aptamer.
    Each has 40nt, 20nt, and 10nt loop parts (shown below as blue parts).
    The blue parts are complementary to the blue trigger strands, and when they hybridize, they place some stress on the liposome and collapse it.
    The red parts are for hybridizing with liposomes. They are complementary to the aptamer on the surface of liposomes.
    The aptamer is the same as that used in i)Bending approach.
    Aptamer DNA
    CCAGAAGACG -cholesterol
    40nt loop DNA
    CGTCTTCTGGTTTTTTTTTTGCGAACCACGGTTCCCAGCGTGACCTTCATGCTTAAGTTTCGTCTTCTGG
    Trigger DNA for 40 nt loop DNA
    AAACTTAAGCATGAAGGTCACGCTGGGAACCGTGGTTCGC
    20nt loop DNA
    CGTCTTCTGGTTTTTTTTTTTTCATAACATGAGGCGCCGTCGTCTTCTGG
    Trigger DNA for 20 nt loop DNA
    ACGGCGCCTCATGTTATGAA
    10nt loop DNA
    CGTCTTCTGGTTTTTTTTTTCTGTAACTAACGTCTTCTGG
    Trigger DNA for 10 nt loop DNA
    TTAGTTACAG

    Personal tools