Protocol

Contents

1 Step1 Disruption of temperature sensitive liposomes

1-1 Disruption of temperature sensitive liposomes

Structure of NIPAM

poly-N-isopropyl acrylamide
Making liposome
Egg York PC(10mM) 10µl
Cholesterol(10mM) 1µl
CHCl3 90µl
TXR 1µl
Table1 Materials for Making liposomes

1. Drying the liposomes above with argon gas and letting them stand for a night
2. Adding L paraffin 100µl to 1 and sonicating them for an hour
3. Picking up 10µl from 2, adding 25μl NIPAM2mg/ml to them and vibrating them with Vortex

2 Step2 Liposome disruption induced by attachment of key DNA with anchor DNA

2-1 DNA Origami approach

2-1-1 Making DNA Origami
Making DNA origami
DNA origami recipe
We designed DNA origami by caDNAno2, software for designing 2D and 3D DNA origami.
Our DNA origami has 141 staples that have 30nt free single-stranded parts outside the DNA origami. The sequence of the parts is each DNA origami staple-TTTTTTTTTTTTTTTCTGTCGCATCGAGAG.
Between the staple and unique (CTGTCGCATCGAGAG) sequences, 15 T bases are inserted. They are to make a T loop. Thanks to this T loop, single-stranded DNA complementary to the unique sequences (such as Origami-anchor DNA) are expected to easily hybridize with the unique sequence.
The 30nt single-stranded parts are stable till 37 degrees, according to NUPACK).
The 141 staples have the same length so that they may be present at the same intervals in the DNA origami.
Each side of our origami is not fully covered with staples, and single-stranded M13 remains. This is for preventing π-π interaction and stacking by hydrophobic interaction between base pairs of double-stranded DNA.
This design enables each DNA origami to exist individually.

The list of strands
The other strands exept DNA origami staples used in our experiment are shown in Table2.
The sequence of Origami-anchor DNA is shown below (at the first sequence in Table2). For labeling, we also attached fluorescent-tagged DNA (at the second in Table2) to our DNA origami.
To hybridize both Origami-anchor DNA and fluorescent-tagged DNA with the same unique single-stranded parts of our Origami, we arranged two kinds of adaptor DNA (at the third and fourth in Table2). One adaptor has complementary sequences to both the unique sequence and Origami-anchor DNA. The other has complementary sequences to both the unique sequence and the fluorescent-tagged DNA. Thanks to these two adaptors, two different strands can bind to the same unique sequence.

The kinds of DNAtrands Its sequence
Origami-anchor DNA CCAGAAGACG
Fluorescent-tagged DNA ACTAGTGAGTGCAGCAGTCGTACCA
Adaptor strand for Origami-anchor DNA and the unique sequence in DNA origami CGTCTTCTGGCTCTCGATGCGACAG
Adaptor strand for fluorescent-tagged DNA and the unique sequence in DNA origami TGGTACGACTGCTGCACTCACTAGTCTCTCGATGCGACAG
Table2 The sequence of the strands

Annealing of DNA origami
The annealing solution is shown in Table3. The annealing was conducted for 2 hours and 51minutes (from 95 to 25 degrees: lower 1 degree per 2 minutes).

  • Annealing solution with fluorescent-tagged DNA 50µl
    84nM M13mp18 2.38µl
    Staples
    1µM migihaji 1µl
    1µM hidarihaji 1µl
    1µM ashibatemae 1µl
    200nM ashiba 5µl
    1µM cholesterol-hybridizing ssDNA 3µl
    1µM fluorescent-tagged DNA-hybridizing ssDNA 3µl
    5xTAE Mg2+ 10µl
    mQ 20.62µl
    1µM fluorescent-tagged DNA 3µM
  • Table3 Annealing solution with fluorescent-tagged DNA

  • Annealing solution with no fluorescent-tagged DNA (control) 50µl
    We changed 3µl fluorescent-tagged DNA in the above solution into the same quantity of mQ.


  • 2-1-2 Labeling DNA Origami with fluorescent-tagged DNA
    Electrophoresis
    We confirmed that our DNA origami was fluorescently labeled by electrophoresis.

    50µl of Annealing solution with fluorescent-tagged DNA (used in 2-1-1 Making DNA origami) contains 3µl of 1µM fluorescent-tagged DNA.
    To see if the origami binds to the fluorescent-tagged DNA in shorter time, we added 0.6µl of 1µM fluorescent-tagged DNA into 10 µl control annealing solution, and left it for 40 minutes.

    Agarose gel recipe: 0.4g agarose, 0.8ml 50xTAE, 39.2ml mQ

    The electrophoresis was conducted with 1% agarose gel, CV 100V, for 50 minutes.

    2-1-3 Disruption of liposomes by DNA Origami (microscopic analysis)
    Making liposome
    1. Drying the liposomes below with argon gas and letting them stand for a night
    2. Adding 1xTAE Mg2+ 100µl to 1 and heating it in warm water (about 90 deg C) for a few hours

    DOPC (10mM) 1µl
    CHCl3 99µl
    Table4 Materials for Making liposomes

    Concentration of Origami-anchor DNA
    To float Origami-anchor DNA on the surface of liposome, we added Origami-anchor DNA into liposomes at the final concentration of 0.018, 0.069, 1.8, and 6.9µM. Each sample was as follows.
  • Liposome with 0.018µM Origami-anchor DNA: 1µl 0.1µM Origami-anchor DNA and 2.5µl liposome
  • Liposome with 0.069µM Origami-anchor DNA: 10µl 0.1µM DNAs and 2.5µl liposome
  • Liposome with 1.8µM Origami-anchor DNA: 1µl 10µM DNAs and 2.5µl liposome
  • Liposome with 6.9µM Origami-anchor DNA: 10µl 10µM DNAs and 2.5µl liposome

  • Observation by phase and fluorescent microscope
    We observed each sample with a phase microscope.

    Then we added 2µl DNA origami into each sample and saw if some change would happen with a fluorescent microscope.
    The DNA origami for fluorescent microscope observation was made according to Table5 annealing solution. It contained more cholesterol-hybridizing ssDNAs and fluorescent-tagged DNA-hybridizing ssDNAs than Annealing solution used in 2-1-1, because we considered a sample with more fluorescent molecules was suitable for observation.

    84nM M13mp18 2.38µl
    Staples
    1µM migihaji 1µl
    1µM hidarihaji 1µl
    1µM ashibatemae 1µl
    200nM ashiba 5µl
    100µM cholesterol-hybridizing ssDNA 4.23µl
    100µM fluorescent-tagged DNA-hybridizing ssDNA 4.23µl
    5xTAE Mg2+ 10µl
    mQ 23.54µl
    Table5 50µl Annealing solution for fluorescent microscope observation

    After annealing, we added 4.23µl 100µM fluorescent-tagged DNA (the same quantity of fluorescent-tagged DNA-hybridizing ssDNA).

    2-1-4 Disruption of liposomes by DNA Origami (quantitative analysis)
    Making liposome
    Liposomes were formed by the droplet-transfer method (Pautot et al., PNAS, 2003).
    DOPC(10mM) 20µl
    DPPC(10mM) 20µl
    Cholesterol(10mM) 20µl
    DOPE(10mM) 20µl
    chloroform 260µl
    Table6 Materials for Making liposomes

    1 Drying the liposomes above with argon gas and letting them stand for a night
    2 Adding mineral oil 260µl to 1 and sonicating them (43Hz, 60 deg C, for 2 hours)
    3 Preparing 1.5ml microtube and pouring outer buffer 50µl. Then picking up 50µl from 2 and adding it on the outer buffer (softly, to make a bilayer)

    glucose(1M) 125µl
    25xTAE Mg2+ 10µl
    mQ 110µl
    Table7 Outer Buffer (250µl)


    4 Preparing 0.2 ml microtube and pouring inner buffer 2µl. Then picking up 50µl from 2, adding it on the inner buffer, and mixing them by tapping

    GFP(0.5 mM) 5µl
    sucrose(1M) 125µl
    25xTAE Mg2+ 10µl
    mQ 110µl
    Table8 Inner Buffer (250µl)

    5 Pouring all the solution (52µl) of 4 into the 1.5ml tube (softly, to make a three-layer) 6 Centrifuging it for 30 seconds and taking only the bottom layer

    Disruption of liposomes by DNA Origami
    Sample1 is the negative control. It is the mixture of liposome and Origami-anchor DNA.
    Liposome (with GFP inside) (4mM) 10µl
    Origami-anchor DNA (10uM) 25µl
    1xTAE Mg2+ 75µl
    Table9 Sample1: negative control

    Sample2 is the positive control. It is the mixture of liposome, Origami-anchor DNA, and surfactant (NP40).
    Liposome (with GFP inside) (4mM) 10µl
    Origami-anchor DNA (10uM) 25µl
    1xTAE Mg2+ 75µl
    Surfactant (NP40) 2µl
    Table10 Sample2: positive control

    Sample3 is the mixture of liposome, Origami-anchor DNA, and Key DNA Origami.
    Liposome (with GFP inside) (4mM) 10µl
    Origami-anchor DNA (10uM) 25µl
    1xTAE Mg2+ 55µl
    Key DNA (5nM) 20µl
    Table11 Sample3

    1. Adding Origami-anchor DNA to each sample, and leaving it for 30 minutes.
    2. Adding Key DNA to each sample, and leaving it for 10 minutes.
    3. Taking each sample 50µl and measuring each sample’s fluorescence intensity of 7-13 µm diameter liposomes by Cell Lab Quanta SC Flow Cytometer.

    2-1-5 Confirming sequence specificity of DNA
    Making liposome
    We made liposomes in the same way as 2-1-4.
    The list of strands
    To confirm sequence specificity of DNA, we prepared two different pairs of Origami-anchor DNA and adaptor strand.
    We call Key DNA with adoptor strand(A) as Key DNA(A) and Key DNA with adoptor strand(B) as Key DNA(B) .

    The kinds of DNAtrands Its sequence
    Origami-anchor DNA(A) CCAGAAGACG
    Adaptor strand for Origami-anchor DNA(A) CGTCTTCTGGCTCTCGATGCGACAG
    Origami-anchor DNA(B) TCCACTAACG
    Adaptor strand for Origami-anchor DNA(B) CGTTAGTGGACTCTCGATGCGACAG
    Table12 The sequence of the strands

    Confirming sequence specificity of DNA
    Sample1 has complementary Origami-anchor DNA(A) and Key DNA(A).
    Liposome (with GFP inside) (4mM) 10µl
    Origami-anchor DNA(A) (10uM) 25µl
    1xTAE Mg2+ 55µl
    Key DNA(A) (5nM) 20µl
    Table13 Sample1

    Sample2 has Origami-anchor DNA(A) and Key DNA(B).
    Liposome (with GFP inside) (4mM) 10µl
    Origami-anchor DNA(B) (10uM) 25µl
    1xTAE Mg2+ 55µl
    Key DNA(B) (5nM) 20µl
    Table14 Sample2

    The processes to mix liposomes, Origami-anchor DNA and Key DNA are the same as 2-1-4.



    2-2 Flower DNA approach

    2-2-1 Disruption of liposomes by Flower DNA
    The protocol to prepare liposomes was the same as that in 2-1-4.
    STE 10µl
    glucose (1M) 250µl
    HEPES (1M) 5µl
    MgCl2 (1M) 6.25µl
    mQ 228.8µl
    Table15 500µl outer buffer

    GFP 10µl
    glucose (1M) 250µl
    HEPES (1M) 5µl
    MgCl2 (1M) 6.25µl
    mQ 228.8µl
    Table16 Inner buffer (green)

    Texas-Red dextran 20µl
    glucose (1M) 250µl
    HEPES (1M) 5µl
    MgCl2 (1M) 6.25µl
    mQ 218.8µl
    Table17 Inner buffer (red)

    DOPC (10mM) 20µl
    DPPC (10mM) 20µl
    cholesterol (10mM) 20µl
    Table18 Phase-separated liposome

    1. Tapping of inner buffer 2µl and lipid paraffin 50µl
    2. Putting L paraffin 50µl on outer buffer 50µl
    3. Putting 1(inner buffer + lipid paraffin) on 2 (L paraffin +outer buffer)
    4. Centrifuging 3 sample for 5minutes
    5. Observing leak of liposomes from the bottom of tubes by needles
    2-2-2 Confirming sequence specificity of DNA
    The protocol of outer buffer and inner buffer(green) was the same as that in 2-2-1. As for the inner buffer (red), below is the recipe.
    Texas-Red dextran 100µl
    glucose (1M) 250µl
    HEPES (1M) 5µl
    MgCl2 (1M) 6.25µl
    mQ 138.8µl
    Table19 Inner buffer (red)

    We named liposomes with GFP inside “liposome A”, and liposomes with Texas-Red dextran “liposome B”.
    Each liposome has different Flower-anchor DNA.
    1. Making liposomes by the same method as 2-2-1
    2. Adding liposome A 3µl into 5µl Flower-anchor DNA for liposome A(50µM); adding liposome B 3µl into Flower-anchor DNA for liposome B(50µM)

    The kinds
    of DNAtrands
    Its sequence
    10nt Flower-anchor DNA(A) CCAGAAGACG
    50nt Flower-anchor DNA(A) CGTCTTCTGGGCGAACCACGGTTCCCAGCGTGACCTTCATGCTTAAGTTT
    10nt Flower-anchor DNA(B) TCCACTAACG
    50nt Flower-anchor DNA(B) CGTTAGTGGAGTATCCGTCAACCGCACCTATGGCAGCAAGTGAGCCTGTA
    Table20 The sequence of Flower-anchor DNA

    3. Taking 4µl of each liposome and mixing them
    4. Adding Key DNA (100µM) for liposome B 4µl into 3
    Preparing control sample : instead of Key DNA, adding buffer solution (10mM HEPES Mg+2, 4µl)