Biomod/2013/Todai/Design: Difference between revisions

Revision as of 04:34, 31 August 2013

<style> <!--

body{

 font-family:Verdana;
 Myriad Pro;
 Arial;
 background-color: #fffc77;
 overflow-y:scroll;
 overflow-x:hidden;
 }

article{

 background-color: #ffffff
 }

.Logo {

 position: relative;
 left: -39px;
 }

.zairyou-heading {

 font-size: 120%;
 position: relative;
 left:30px;
 line-height: 2.2;
 }

.zairyou-heading-sub {

 font-size: 110%;
 position: relative;
 left:30px;
 line-height: 2.2;
 }

.zairyou-list {

 font-size: 100%;
 position: relative;
 left: 40px;
 }

p.paragraph{

 font-size :110%;
 line-height:1.5;
 margin:0 20px;
 text-indent: 1em;
 }

p.noindent-paragraph {

 font-size :110%;
 line-height:1.5;
 margin:0 20px;
 }

p.item {

 font-size :110%;
 line-height:1.5;
 margin:0px 20px;
 text-indent: 2em;
 }

h1.title a{

 font-size :90%;
 font-style:italic;
 display: block;
 text-decoration: none;
 color: #000000;

　font-weight:bolder;

 border-left: solid 5px #e00000 
 }

h1.big-title a{

 font-size :110%;
 display: block;
 text-decoration: none;
 color: #000000;

　font-weight:300;

h1.heading a{

 font-size :95%;
 display: block;
 text-decoration: none;
 color: #000000;

　font-weight:100;

 border-left: solid 7px #ffa500
 }

h2.small-title a{

 font-size :100%;
 display:block;
 text-decoration: none;

　font-weight:bolder;

 color: #e00000;
 }

.sidebar {

 font-size: 110%;
 width: 110px;
 background-color: #ffffff;
 padding: 7px;
 position: fixed;
 top: 167px;
 left: auto;
 z-index: 20;
 margin: 0 0 0 -175px;
 border:solid 1.5px orange;
 }

.sidebar ul {

 position:relative;
 top:-3px;
 left:-3px;
 }

.sidebar ul li ul {

 list-style: none;
 position: relative;
 left: -15px
 }

.sidebar ul li ul li a{

 font-size: 85%;
 }

a:link {color:#000000;} a:visited {color:#000000;} a:hover {color:#e00000;} a:active {color:#e00000;}

.Return-Logo a{

 position: fixed;
 bottom: 10px;
 left: auto;
 margin: 0 0 0 789px;
 z-index: 20;
 display:block;
 width:60px;
 height:0px;
 padding-top:60px;
 background:url(http://openwetware.org/images/b/b1/Return-top-0828new.png);
 overflow:hidden;
 }

.Return-Logo a:hover {

 background-position: left bottom;
 }

.reference-title a{

 color:#000000;
 font-size:110%;
 font-weight:bolder;
 text-decoration:none;
 }

.reference-author {

 font-size:110%;
 position:relative;
 left:30px;
 }

.reference-journal {

 font-size:110%;
 font-style:italic;
 position:relative;
 left:30px;
 }

.ref-sup a{

 vertical-align:super;
 color:#e00000;
 text-decoration:none;
 }

column-one { display:none; width:0px;}

.container{background-color: #ffffff; margin-top:0px} .OWWNBcpCurrentDateFilled {display: none;}

content { width: 0px; margin: 0 auto auto 0; padding: 0em 0em 0em 0em; align: center;}
column-content {width: 0px; float: left; margin: 0 0 0 0;padding: 0;}

.firstHeading {display:none; width:0px;}

globalWrapper{width:800px; background-color: #ffffff; margin-left: auto; margin-right: auto}
column-one {display:none; width:0px;background-color: #ffffff;}
content{ margin: 0 0 0 0;padding: 12px 12px 12px 12px; width:775px;border: 0;}
bodyContent{ width: 730px; align: center; background-color: #ffffff;position:relative;left:20px;}
column-content{width: 800px;background-color: #ffffff;}
footer{position: center; width: 800px}

-->

</style> </head>

<body>

   <div id="top">	
     <figure>
       <div  class="Logo">
         <img src="http://openwetware.org/images/9/9c/Logo-OCKver.png" width=730px height=128px>
       </div>
     </figure>
   </div>
   <br>

 <ul>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai">Home</a>
    </li>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Project">Project</a>
    </li>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Design">Design</a>
    </li>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Result">Result</a>
    </li>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Experiment">Experiment</a>
       <ul style="list-style-type: none;">

<li>

          <a href="http://openwetware.org/wiki/Biomod/2013/Todai/Experiment#Contents">
          Contents</a></li>
          <li>
          <a href="http://openwetware.org/wiki/Biomod/2013/Todai/Experiment#PilotStudy">
          Pilot Study</a></li>
          <li>
          <a href="http://openwetware.org/wiki/Biomod/2013/Todai/Experiment#Protocols">
          Protocols</a></li>
       </ul>
    </li>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Team">Team</a>
    </li>
    <li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Sponsors">Sponsors</a>
    </li>
 </ul>

</div>

 <a href="#TOP">
   <figure>
     <img src="http://openwetware.org/images/b/b1/Return-top-0828new.png" width:60px height:60px>
   </figure>
 </a>

</div>

</body> </html>

<html> <head> <title>Design-Todai nanORFEVRE-</title> <style>

.rightbar-des {

 font-size: 90%;
 width: 155px;
 background-color: #ffffff;
 padding: 5px;
 padding-right:0px;
 position: fixed;
 top: 220px;
 left: auto;
 z-index: 20;
 margin: 0 0 0 797px;
 border:solid 1.5px orange;
 }

.rightbar-des ul {

 position:relative;
 left:-15px;
 line-height:1.5;
 list-style:none;
 }

.rightbar-des ul li {

.rightbar-des ul li ul li{

 position:relative;
 left:10px;
 }

.reference-title {

 font-size:110%;
 font-weight:bolder;
 }

.reference-author {

 font-size:110%;
 }

.reference-journal {

 font-size:110%;
 font-style:italic;
 }

</style>

</head>

<body>

 <ul>
    <li><a href="#1.Oligomeric Cell Killer">1. Oligomeric Cell Killer</a>
       <ul>
         <li><a href="#1-1.General design">1-1.<br>General design</a>
         </li>
       </ul>
    </li>
    <li><a href="#2.Cylinder in barrel by DNA origami">2. Cylinder in barrel</a>
       <ul>
          <li><a href="#2-0.Purpose">2-0. <br>Purpose</a>
          </li>
          <li><a href="#2-1.Geometrical features">2-1. <br>Geometrical features</a>
          </li>
          <li><a href="#2-2.Functional features">2-2. <br>Functional features</a>
          </li>
       </ul>
    </li>
 </ul>

</div>

  <h1 class="big-title"><a name="Design">&nbsp;Design</a></h1>
  <br>

  <h1 class="heading"><a name="1.Oligomeric Cell Killer">&nbsp;1. Oligomeric Cell Killer</a></h1>

  <article>
   <h1 class="title"><a name="1-1.General design">&nbsp;1-1. General design</a></h1>
   <br>

    <p class="paragraph">

Inspired by immune system, our goal is to fablicate pore forming DNA nanostructure killing the cancer cell. The designed structure is shown below. Our design is characterized with three features: a broad plane part to anchor on the cell surface, bend of side edges to invade into the cell membrane, and connectable sites for oligomization.

    </p>
    <br>

    <figure>
     <center>
      <img src="http://openwetware.org/images/a/ac/Des1-Todai.png" width="300" height="300">
     <figcaption style="font-size:110%;position:relative;left:-20px;">
     General Design
     </figcaption>
     </center>
    </figure>
    <br>

    <p class="paragraph">

It requires enough free energy to penetrate membranes. This is compensated by the free energy gained from biding of the DNA nanostructure bound cholresterols to the lipid bilayer. The more cholesterols are equipped to the structure, the more stabilized it stays near the membrane. A broad plane gives much cholesterol binding sites, so this feature might be suitable to penetrate membranes. Although previous reseach (Danilo D. Lasic, et al.)<span class="ref-sup"><a href="#desref-1">[1]</a></span> reported the non-specific binding of DNA to the liposome, which is usually an undesiable feature, we thought that we could utilized this feature positively by means of the broad plane. Integrating broad plane into our DNA nanostructure, we expect some free energy gain by the non-specific binding of the broad plane to the bilayer, which may stabilize the binding of our DNA structure to the bilayer.

    </p>
    <p class="paragraph">

To achieve an efficient pore forming system, one should balance between the cost of penetration of the nanostructure into the bilayer and the binding stability of the nanostructure to the bilayer. To overcome this dilemma, we introduced the "bend of side edges", which allow us to minimizing the penetration part, but also maximizing the anchoring part.

    </p>
    <p class="paragraph">

To oligomerize, the DNA nanostructure must have some binding site to each other. Therefore, we introduced "connectable sites" into our nanostructure. It should be noted that hybridization is used for oligomerization method in the figure, we examine other method as well.

    </p>
    <br>
    <p class="paragraph">

Although we thought carefully, above design are mainly derived from speculation. We, therefore, need more information (e.g. interaction between DNA and liposome) to design our nanostructure more specifically. Thus, ss a first step toward our goal, we started with simple DNA origami structure: Cylinder in Barrel.

    </p>

  </article>
  <br>
  <br>

  <h1 class="heading"><a name="2.Cylinder in barrel by DNA origami">&nbsp;2. Cylinder in barrel by DNA origami</a></h1>
  <br>

  <center>
  <iframe width="420" height="315" src="http://www.youtube.com/embed/2I802ed96t0?rel=0" frameborder="0" allowfullscreen>
  </iframe>
  </center>
  <br>

  <article>
   <h1 class="title"><a name="2-0.Purpose">&nbsp;2-0. Purpose</a></h1>
   <br>

    <p class="paragraph">
    This barrel structure was designed first in order to get some feedback for our general design. caDNAno(version 2.2)was used to design the structure, and M13mp18 was chosen as the scaffold strand.
    </p>
    <br>
    
    <p class="paragraph">General design needs to oligomerize and form pore on the membrane, so we check following things by Cylinder.</p>

     <center>
       <figure>
         <img src="http://openwetware.org/images/4/42/Des2_0purpose-Todai.png" width="420" height="420" style="border:solid 1.5px black;">
        <br>
        <br>
       <figcaption style="position:relative;left:-10px;">
       What is intended to confirm by "Cylinder".
       </figcaption>
       </figure>
     </center>
    <br>

    <p class="item">1) Can DNA nanostructures penetrate lipid membranes?</p>
    <p class="item">2) Can DNA nanostructures bind each other and make dimer(or more complex structure )in solution?</p>
    <p class="item">3) Is that connection possible with penetrating membranes?</p>
    <p class="item">4) Can the direction of connection be controlled?</p>
    <br>
    <p class="paragraph">Therefore, the structure was equiped with following features.</p>
  
  </article>
  <br>
  <br>
  <br>

  <article>
   <h1 class="title"><a name="2-1.Geometrical features">&nbsp;2-1. Geometrical features</a></h1>
    
    <br>
    <figure>
     <center>
      <img src="http://openwetware.org/images/7/79/BarrelSize-Todai.png" width="300px" height="300px" >
     <figcaption style="position:relative;left:-25px;">
     The dimentions of a cylinder in barrel
     </figcaption>
     </center>
    </figure>
    <br>

    <p class="paragraph">
    To get reliable information, the design of  cylinder needs to be simple and realistic. We refered to the past research (Martin Langecker et al.)<span class="ref-sup"><a href="#desref-2">[2]</a></span>and designed geometrical features.
    </p>

    <p class="paragraph">
The cylinder domain is about 65nm long(195bp) and consists of six dsDNA helixes, so its diameter is 6nm long. The barrel domain is approximately 43nm long(128bp) and 48 helixes builds this domain. Because the  part of the cylinder sticking out needs to penetrate lipid membranes, which is 2nm thick liposome used in experiments, the length of that part(about 20nm) is enough to go through lipid membranes. By covering the cylinder with barrel, this structure can be equiped with more cholesterols than that without barrels.</p>
    <p class="paragraph">
    (Cholesterol is necessary to penetrate membranes, about which is written in next section.)
    </p>

  </article>
  <br>

  <article>
   <h1 class="title"><a name="2-2.Functional features">&nbsp;2-2. Functional features</a></h1>
    
    <br>
    <figure>
     <center>
      <img src="http://openwetware.org/images/a/a1/BarrelCholesterol-Todai.png" width="300px" height="300px" >
      <br>
      <br>
     <figcaption style="position:relative;left:-10px;">
     How "Cylinder" penetrates membranes
     </figcaption>
     <figcaption style="position:relative;left:-10px;">
     (This arrangement of lipids is refered to previous research. <span class="ref-sup"><a href="#desref-2">[2]</a></span>)
     </figcaption>
     </center>
    </figure>
    <br>

    <p class="paragraph">
    Because DNA has negative charge, the DNA nanorobots have to gain some energy to penetrate lipid membrane, which is composed of amphiphilic molecules. This problem is solved by binding cholesterols to the structures. The barrel domain has 26 staple strands complementary to cholesterol modified DNA oligo, and the oligomers are hybridized to these staples.The DNA structure anchors itself to membrane by cholesterols, and it gives stability for the structure to stay near membranes.Therefore, the structure can pierce lipid bilayer.
    </p>
    <br>

   <center>
     <table cellpadding="0">
       <tr>
       <td>
       <figure>
         <img src="http://openwetware.org/images/e/e3/Des2_2_3rdparagraph1-Todai.png" width="200px" height="200px" >
         <figcaption>[Mechanism of binding-1]</figcaption>
         <figcaption>
         dimerized by the strands <br>
         sticking out from the top
         </figcaption>
       </figure>
       </td>

       <td>
       <figure>
         <img src="http://openwetware.org/images/7/7a/Des_2_2_3rdparagraph2-Todai.png" width="200px" height="200px" >
             <figcaption>[Mechanism of binding-2]</figcaption>
             <figcaption>dimerized by the strands <br>
             sticking out from the side
             </figcaption>
       </figure>
       </td>
       </tr>
     </table>
   </center>

    Three different sequences of staples to hybridize cholesterol modified oligomers were prepared.
    </p>

    <p class="item">

1:CCTCTCACCCACCATTCATC (from previous research(Alexander johnson-Buck et al.<span class="ref-sup"><a href="#desref-3">[3]</a></span>))

    </p>
    <p class="item">

2:TAACAGGATTAGCAGAGCGAGG (from previous research(Martin Langecker et al.<span class="ref-sup"><a href="#desref-2">[2]</a></span>))

    </p>
    <p class="item">

3:GGAACTTCAGCCCAACTAACATTTT

    </p>

    <p class="noindent-paragraph">

They are different in the length of the hybridizing sequence. About cholesterol modified oligomers, their sequences are perfectly complementary to the three sequences above, and their 5' ends are modified by a cholesterol.

    </p>
    <p class="paragraph">

To achieve the purpose iii), the structure has binding site by hybridization. Two pairs of sequences were assigned for hybridization. Both are refered to previous work about logic-gated nanorobot of DNA(Shawn M. Douglas, et al.

    <span class="ref-sup"><a href="#desref-4">[4]</a></span>).
    They are derived from aptamer sequence,one is TE17, the other is sgc8c(and the complementary strands to these, so two pairs). These sequences were chosen because it is considered that these sequences don't prevent the folding of scaffold. The sequences of them are below:
    </p>

    <p class="item">1:TCTAACCGTACAGTATTTTCCCGGCGGCGCAGCAGTTAGA TT(sgc8c aptamer + TT)
    </p>
    <p class="item">2:TT CAGCACCCAGTCAGAAGCAGGTGTTCGGAGTTTTGTATTGCGTAGCTG(TT+ TE17 aptamer )
    </p>

    <p class="noindent-paragraph">
    Designed structures have either the aptamer sequences(1,2) or the two complementary strands(1,2). When two structures with different pairs are mixed and hybridization happens, these structures hence bind each other through two binding sites. Two types of binding sites were designed to test that the direction of connection can be controlled. One type of binding site uses staples sticking out from the ends of scaffolds. The other from near sites, but the direction in which staples stick out is controlled. It is intended to controll the direction of binding by the intereference between structure and hybridized aptamers.
    </p>

    <figure>
     <center>
      <img src="http://openwetware.org/images/5/5a/Des_2_2_4thparagraph-Todai.png" width="300px" height="300px" >
     <figcaption style="position:relative;left:-20px">
     Fluorescent materials are equipped 
     <br>by streptavidin-biotin interaction.
     </figcaption>
     </center>
    </figure>
    <br>

    <p class="paragraph">

To detect the cylinder piercing membrane, two biotin modified staple strands are out from its bottom. Streptavidins with fluoresence bind them in advance, and only the cylinders penetrating liposome are protected from protease when the cylinders are mixed with liposome. Therefore, it is possible to observe whether there are cylinders penetrating by their fluoresence.

    </p>

    <br>
    <p class="paragraph">

From the results of experiments with “Cylinder” we will decide our final design.

    </p>
  </article>
  <br>
  <br>
  <br>

  <article>
    <h1 class="title"><a name="References">&nbsp;References</a></h1>
    <br>

    <div>     
       <div class="reference-title">
         <a name="desref-1">
         [1] The Structure of DNA−Liposome Complexes
         </a>
       </div>
          <div class="reference-author">
          Danilo D. Lasic,Helmut Strey, Mark C. A. Stuart, Rudolf Podgornik,  and Peter M. Frederik
          </div>
             <div class="reference-journal">
             Journal of the American Chemical Society 1997 119 (4), 832-833 
             </div>
    </div>
    <br>
    <div>     
       <div class="reference-title">
       <a name="desref-2">
       [2] Synthetic Lipid Membrane Channels Formed by Designed DNA Nanostructures 
       </a>
       </div>
          <div class="reference-author">
          Martin Langecker, Vera Arnaut, Thomas G. Martin, Jonathan List, Stephan Renner, Michael Mayer, Hendrik Dietz, and Friedrich C. Simmel
          </div>
             <div class="reference-journal">
             Science 16 November 2012: 338 (6109), 932-936. [DOI:10.1126/science.1225624] 
             </div>
    </div>
    <br>
    <div>     
       <div class="reference-title">
       <a name="desref-3">
       [3] Multifactorial Modulation of Binding and Dissociation Kinetics on Two-Dimensional DNA Nanostructures
       </a>
       </div>
          <div class="reference-author">
          Alexander Johnson-Buck, Jeanette Nangreave, Shuoxing Jiang, Hao Yan, and Nils G. 
          </div>
             <div class="reference-journal" style="font-style:italic;">
             WalterNano Letters 2013 13 (6), 2754-2759
             </div>
    </div>
    <br>
    <div>     
       <div class="reference-title">
       <a name="desref-4">
       [4] A logic-gated nanorobot for targeted transport of molecular payloads. 
       </a>
       </div>
          <div class="reference-author">
          S. M. Douglas, I. Bachelet, G. M. Church
          </div>
             <div class="reference-journal">
             Science 335, 831 (2012)
             </div>
    </div>

  </article>
  <br>
  <br>
  <br>
  <br>
  <br>
  <br>
  <br>
  <br>

Biomod/2013/Todai/Design: Difference between revisions

Revision as of 04:34, 31 August 2013

Navigation menu

Page actions

Page actions

Personal tools

Navigation

Search

research

Tools

@@ Line 93: / Line 93: @@
      <h1 class="title"><a name="1-1.General design">&nbsp;1-1. General design</a></h1>
      <br>
+     <p class="paragraph">
+Inspired by immune system, our goal is to fablicate pore forming DNA nanostructure killing the cancer cell. The designed structure is shown below. Our design is characterized with three features: a broad plane part to anchor on the cell surface, bend of side edges to invade into the cell membrane, and connectable sites for oligomization.
+     </p>
+     <br>
       <figure>
@@ Line 105: / Line 110: @@
       <p class="paragraph">
-     It is our goal for DNA nanostructure to kill a cell by forming a pore  like MAC in immune system. Therefore, we intended to design a DNA nanostructure which imitates its pore formation system by oligomerizaton. The designed structure is shown below, and this design is characterized with three features: a broad plane, bend of side edges and connectable sites.
+It requires enough free energy to penetrate membranes. This is compensated by the free energy gained from biding of the DNA nanostructure bound cholresterols to the lipid bilayer. The more cholesterols are equipped to the structure, the more stabilized it stays near the membrane. A broad plane gives much cholesterol binding sites, so this feature might be suitable to penetrate membranes. Although previous reseach (Danilo D. Lasic, et al.)<span class="ref-sup"><a href="#desref-1">[1]</a></span> reported the non-specific binding of DNA to the liposome, which is usually an undesiable feature, we thought that we could utilized this feature positively by means of the broad plane. Integrating broad plane into our DNA nanostructure, we expect some free energy gain by the non-specific binding of the broad plane to the bilayer, which may stabilize the binding of our DNA structure to the bilayer.
-     </p>
-     <p class="paragraph">
-     It requires enough free energy to penetrate membranes. By anchoring to the lipid bilayer by cholesterol modified staples, the DNA nanostructure is expected to get over the potential barrier. The more cholesterols are equipped to the structure, the more stabilized it stays near the membrane. A broad plane gives much cholesterol binding sites, so this feature is suited to penetrate membranes.
       </p>
       <p class="paragraph">
-     From previous(Danilo D. Lasic, et al.) research <span class="ref-sup"><sup><a href="#desref-1">[1]</a></sup></span>, it is suspected that DNA nonspecifically interacts with liposomes. Hence it seems the designed structure should not have any broad plane contactable to membrane undesirably, but that we thought we take advantage of this enforced interaction and can prevent undesirable connection to the membrane. So this broad plane do good rather than do harm.
+To achieve an efficient pore forming system, one should balance between the cost of penetration of the nanostructure into the bilayer and the binding stability of the nanostructure to the bilayer. To overcome this dilemma, we introduced the "bend of side edges", which allow us to minimizing the penetration part, but also maximizing the anchoring part.
       </p>
       <p class="paragraph">
-     To oligomerize, the DNA nanostructure must have some binding site to each other. Though hybridization is used as the method of oligomerization in the figure, but we examine other method as well.
+To oligomerize, the DNA nanostructure must have some binding site to each other. Therefore, we introduced "connectable sites" into our nanostructure. It should be noted that hybridization is used for oligomerization method in the figure, we examine other method as well.
       </p>
       <br>
       <p class="paragraph">
-     This general design with these features  are mainly derived from prediction, and were information necessary to design our nanostructure more specifically, for example,  we need to know about the interaction between DNA and liposome(as cell membrane) and develop assay. We simplyfied our general design, and made “Cylinder in barrel”. We did some experiments with “Cylinder in barrel” in advance to the more specific design.
+Although we thought carefully, above design are mainly derived from speculation. We, therefore, need more information (e.g. interaction between DNA and liposome) to design our nanostructure more specifically. Thus, ss a first step toward our goal, we started with simple DNA origami structure: Cylinder in Barrel.
       </p>