Biomod/2013/Todai/Design: Difference between revisions
Kenta Koyama (talk | contribs) No edit summary |
Kenta Koyama (talk | contribs) No edit summary |
||
| Line 171: | Line 171: | ||
<p class="item">1) Can DNA nanostructures penetrate lipid membranes?</p> | <p class="item">1) Can DNA nanostructures penetrate lipid membranes?</p> | ||
<p class="item">2) Can DNA nanostructures bind each other and make dimer(or more complex structure )in solution?</p> | <p class="item">2) Can DNA nanostructures bind each other and make dimer (or more complex structure ) in solution?</p> | ||
<p class="item">3) Can DNA nanostructures dimerize on membrane?</p> | <p class="item">3) Can DNA nanostructures dimerize on membrane?</p> | ||
<p class="item">4) Can the direction of connection be controllable?</p> | <p class="item">4) Can the direction of connection be controllable?</p> | ||
Revision as of 06:07, 31 August 2013
<html> <head> <meta name="viewport" content="width=1200">
<style> <!--
body{
font-family:Verdana; Myriad Pro; Arial; background-color: #fffc77; overflow-y:scroll; overflow-x:hidden; }
article{
background-color: #ffffff }
.Logo {
position: relative; left: -39px; }
.zairyou-heading {
font-size: 120%; position: relative; left:30px; line-height: 2.2; }
.zairyou-heading-sub {
font-size: 110%; position: relative; left:30px; line-height: 2.2; }
.zairyou-list {
font-size: 100%; position: relative; left: 40px; }
p.paragraph{
font-size :110%; line-height:1.5; margin:0 20px; text-indent: 1em; }
p.noindent-paragraph {
font-size :110%; line-height:1.5; margin:0 20px; }
p.item {
font-size :110%; line-height:1.5; margin:0px 20px; text-indent: 2em; }
h1.title a{
font-size :90%; font-style:italic; display: block; text-decoration: none; color: #000000;
font-weight:bolder;
border-left: solid 5px #e00000 }
h1.big-title a{
font-size :110%; display: block; text-decoration: none; color: #000000;
font-weight:300;
}
h1.heading a{
font-size :95%; display: block; text-decoration: none; color: #000000;
font-weight:100;
border-left: solid 7px #ffa500 }
h2.small-title a{
font-size :100%; display:block; text-decoration: none;
font-weight:bolder;
color: #e00000; }
.sidebar {
font-size: 110%; width: 110px; background-color: #ffffff; padding: 7px; position: fixed; top: 167px; left: auto; z-index: 20; margin: 0 0 0 -175px; border:solid 1.5px orange; }
.sidebar ul {
position:relative; top:-3px; left:-3px; }
.sidebar ul li ul {
list-style: none; position: relative; left: -15px }
.sidebar ul li ul li a{
font-size: 85%; }
a:link {color:#000000;} a:visited {color:#000000;} a:hover {color:#e00000;} a:active {color:#e00000;}
.Return-Logo a{
position: fixed; bottom: 10px; left: auto; margin: 0 0 0 789px; z-index: 20; display:block; width:60px; height:0px; padding-top:60px; background:url(http://openwetware.org/images/b/b1/Return-top-0828new.png); overflow:hidden; }
.Return-Logo a:hover {
background-position: left bottom; }
.reference-title a{
color:#000000; font-size:110%; font-weight:bolder; text-decoration:none; }
.reference-author {
font-size:110%; position:relative; left:30px; }
.reference-journal {
font-size:110%; font-style:italic; position:relative; left:30px; }
.ref-sup a{
vertical-align:super; color:#e00000; text-decoration:none; }
- column-one { display:none; width:0px;}
.container{background-color: #ffffff; margin-top:0px} .OWWNBcpCurrentDateFilled {display: none;}
- content { width: 0px; margin: 0 auto auto 0; padding: 0em 0em 0em 0em; align: center;}
- column-content {width: 0px; float: left; margin: 0 0 0 0;padding: 0;}
.firstHeading {display:none; width:0px;}
- globalWrapper{width:800px; background-color: #ffffff; margin-left: auto; margin-right: auto}
- column-one {display:none; width:0px;background-color: #ffffff;}
- content{ margin: 0 0 0 0;padding: 12px 12px 12px 12px; width:775px;border: 0;}
- bodyContent{ width: 730px; align: center; background-color: #ffffff;position:relative;left:20px;}
- column-content{width: 800px;background-color: #ffffff;}
- footer{position: center; width: 800px}
-->
</style> </head>
<body>
<div id="top">
<figure>
<div class="Logo">
<img src="http://openwetware.org/images/9/9c/Logo-OCKver.png" width=730px height=128px>
</div>
</figure>
</div>
<br>
<div class="sidebar">
<ul>
<li><a href="http://openwetware.org/wiki/Biomod/2013/Todai">Home</a>
</li>
<li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Project">Project</a>
</li>
<li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Design">Design</a>
</li>
<li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Result">Result</a>
</li>
<li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Experiment">Experiment</a>
<ul style="list-style-type: none;">
<li>
<a href="http://openwetware.org/wiki/Biomod/2013/Todai/Experiment#Contents">
Contents</a></li>
<li>
<a href="http://openwetware.org/wiki/Biomod/2013/Todai/Experiment#PilotStudy">
Pilot Study</a></li>
<li>
<a href="http://openwetware.org/wiki/Biomod/2013/Todai/Experiment#Protocols">
Protocols</a></li>
</ul>
</li>
<li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Team">Team</a>
</li>
<li><a href="http://openwetware.org/wiki/Biomod/2013/Todai/Sponsors">Sponsors</a>
</li>
</ul>
</div>
<div class="Return-Logo">
<a href="#TOP">
<figure>
<img src="http://openwetware.org/images/b/b1/Return-top-0828new.png" width:60px height:60px>
</figure>
</a>
</div>
</body> </html>
<html> <head> <title>Design-Todai nanORFEVRE-</title> <style>
.rightbar-des {
font-size: 90%; width: 155px; background-color: #ffffff; padding: 5px; padding-right:0px; position: fixed; top: 220px; left: auto; z-index: 20; margin: 0 0 0 797px; border:solid 1.5px orange; }
.rightbar-des ul {
position:relative; left:-15px; line-height:1.5; list-style:none; }
.rightbar-des ul li {
}
.rightbar-des ul li ul li{
position:relative; left:10px; }
.reference-title {
font-size:110%; font-weight:bolder; }
.reference-author {
font-size:110%; }
.reference-journal {
font-size:110%; font-style:italic; }
</style>
</head>
<body>
<!--rightbar-->
<div class="rightbar-des">
<ul>
<li><a href="#1.Oligomeric Cell Killer">1. Oligomeric Cell Killer</a>
<ul>
<li><a href="#1-1.General design">1-1.<br>General design</a>
</li>
</ul>
</li>
<li><a href="#2.Cylinder in barrel by DNA origami">2. Cylinder in barrel</a>
<ul>
<li><a href="#2-0.Purpose">2-0. <br>Purpose</a>
</li>
<li><a href="#2-1.Geometrical features">2-1. <br>Geometrical features</a>
</li>
<li><a href="#2-2.Functional features">2-2. <br>Functional features</a>
</li>
</ul>
</li>
</ul>
</div>
<!--Design-->
<h1 class="big-title"><a name="Design"> Design</a></h1> <br>
<!--1. Oligomeric Cell Killer-->
<h1 class="heading"><a name="1.Oligomeric Cell Killer"> 1. Oligomeric Cell Killer</a></h1>
<!--1-1. Design as an approach to our goal-->
<article> <h1 class="title"><a name="1-1.General design"> 1-1. General design</a></h1> <br>
<p class="paragraph">
Inspired by immune system, our goal is to fablicate pore forming DNA nanostructure killing the cancer cell. The designed structure is shown below. Our design is characterized with three features: a broad plane part to anchor on the cell surface, bend of side edges to invade into the cell membrane, and connectable sites for oligomization.
</p>
<br>
<figure>
<center>
<img src="http://openwetware.org/images/a/ac/Des1-Todai.png" width="300" height="300">
<figcaption style="font-size:110%;position:relative;left:-20px;">
General Design
</figcaption>
</center>
</figure>
<br>
<p class="paragraph">
It requires enough free energy to penetrate membranes. This is compensated by the free energy gained from biding of the DNA nanostructure bound cholresterols to the lipid bilayer. The more cholesterols are equipped to the structure, the more stabilized it stays near the membrane. A broad plane gives much cholesterol binding sites, so this feature might be suitable to penetrate membranes. Although previous reseach (Danilo D. Lasic, et al.)<span class="ref-sup"><a href="#desref-1">[1]</a></span> reported the non-specific binding of DNA to the liposome, which is usually an undesiable feature, we thought that we could utilized this feature positively by means of the broad plane. Integrating broad plane into our DNA nanostructure, we expect some free energy gain by the non-specific binding of the broad plane to the bilayer, which may stabilize the binding of our DNA structure to the bilayer.
</p>
<br>
<p class="paragraph">
To achieve an efficient pore forming system, one should balance between the cost of penetration of the nanostructure into the bilayer and the binding stability of the nanostructure to the bilayer. To overcome this dilemma, we introduced the "bend of side edges", which allow us to minimizing the penetration part, but also maximizing the anchoring part.
</p>
<br>
<p class="paragraph">
To oligomerize, the DNA nanostructure must have some binding site to each other. Therefore, we introduced "connectable sites" into our nanostructure. It should be noted that hybridization is used for oligomerization method in the figure, we examine other method as well.
</p>
<br>
<br>
<p class="paragraph">
Although we thought carefully, above design are mainly derived from speculation. We, therefore, need more information (e.g. interaction between DNA and liposome) to design our nanostructure more specifically. Thus, ss a first step toward our goal, we started with simple DNA origami structure: Cylinder in Barrel.
</p>
</article> <br> <br> <br>
<!--2. Cylinder in barrel by DNA origami-->
<h1 class="heading"><a name="2.Cylinder in barrel by DNA origami"> 2. Cylinder in barrel by DNA origami</a></h1> <br>
<center> <iframe width="420" height="315" src="http://www.youtube.com/embed/2I802ed96t0?rel=0" frameborder="0" allowfullscreen> </iframe> </center> <br>
<!--2-0. Purpose-->
<article> <h1 class="title"><a name="2-0.Purpose"> 2-0. Purpose</a></h1> <br>
<p class="paragraph">
This barrel structure was designed to get some feedback for our final design of “Origomeric Cell Killer (hereafter “OCK")”. CaDNAno (version 2.2) was used to design the structure, and M13mp18 was chosen as the scaffold strand.
</p>
<br>
<p class="paragraph">
OCK needs to be oligomerized and be formed pore on the membrane, so we check following things by Cylinder.
</p>
<center>
<figure>
<img src="http://openwetware.org/images/4/42/Des2_0purpose-Todai.png" width="420" height="420" style="border:solid 1.5px black;">
<br>
<br>
<figcaption style="position:relative;left:-10px;">
What is intended to confirm by "Cylinder".
</figcaption>
</figure>
</center>
<br>
<p class="item">1) Can DNA nanostructures penetrate lipid membranes?</p>
<p class="item">2) Can DNA nanostructures bind each other and make dimer (or more complex structure ) in solution?</p>
<p class="item">3) Can DNA nanostructures dimerize on membrane?</p>
<p class="item">4) Can the direction of connection be controllable?</p>
<br>
<p class="paragraph">
Therefore, the structure was equipped with following features.
</p>
</article>
<br>
<br>
<br>
<!--2-1. Geometrical features-->
<article>
<h1 class="title"><a name="2-1.Geometrical features"> 2-1. Geometrical features</a></h1>
<br>
<figure>
<center>
<img src="http://openwetware.org/images/7/79/BarrelSize-Todai.png" width="300px" height="300px" >
<figcaption style="position:relative;left:-25px;">
The dimentions of a cylinder in barrel
</figcaption>
</center>
</figure>
<br>
<p class="paragraph">
To get reliable information, the design of cylinder needs to be simple and realistic. We designed our Cylinder in Barrel according to Martin Langecker et al.<span class="ref-sup"><a href="#desref-2">[2]</a></span>
</p>
<p class="paragraph">
The cylinder domain is about 65 nm long (195 bp) and consists of six dsDNA helixes, so its diameter is 6 nm. The barrel domain is approximately 44 nm long (128 bp) and 48 helixes build this domain The thickness of bilayer is 2 nm, therefore, our cylinder (about 20 nm penetration part) is enough long to stick into the bilayer. By connecting the cylinder with barrel, our cylinder in barrel structure can be integrated more cholesterols than that without barrels.
</p>
<p class="paragraph">
(Cholesterol is necessary to penetrate membranes, about which is written in next section.)
</p>
</article> <br>
<!--2-2. Functional features-->
<article>
<h1 class="title"><a name="2-2.Functional features"> 2-2. Functional features</a></h1>
<br>
<figure>
<center>
<img src="http://openwetware.org/images/a/a1/BarrelCholesterol-Todai.png" width="300px" height="300px" >
<br>
<br>
<figcaption style="position:relative;left:-10px;">
How "Cylinder" penetrates membranes
</figcaption>
<figcaption style="position:relative;left:-10px;">
(This arrangement of lipids is refered to previous research. <span class="ref-sup"><a href="#desref-2">[2]</a></span>)
</figcaption>
</center>
</figure>
<br>
<p class="paragraph">
Because DNA has negative charge, the DNA nanorobots have to gain some energy to penetrate lipid membrane, which is composed of amphiphilic molecules. This problem is solved by binding cholesterols to the structures. The barrel domain has 26 staple strands complementary to cholesterol modified DNA oligos, and modified oligos are hybridized to these staples. The DNA structure anchors itself to membrane by cholesterols, and it gives stability for the structure to stay near membranes. Therefore, the structure can pierce lipid bilayer.
</p>
<br>
<center>
<table cellpadding="0">
<tr>
<td>
<figure>
<img src="http://openwetware.org/images/e/e3/Des2_2_3rdparagraph1-Todai.png" width="200px" height="200px" >
<figcaption>[Mechanism of binding-1]</figcaption>
<figcaption>
dimerized by the strands <br>
sticking out from the top
</figcaption>
</figure>
</td>
<td>
<figure>
<img src="http://openwetware.org/images/7/7a/Des_2_2_3rdparagraph2-Todai.png" width="200px" height="200px" >
<figcaption>[Mechanism of binding-2]</figcaption>
<figcaption>dimerized by the strands <br>
sticking out from the side
</figcaption>
</figure>
</td>
</tr>
</table>
</center>
<p class="paragraph">
To hybridize cholesterol modified oligos, three different sequences of staples were prepared.
</p>
<p class="item">
1:CCTCTCACCCACCATTCATC (Alexander johnson-Buck et al.<span class="ref-sup"><a href="#desref-3">[3]</a></span>)
</p>
<p class="item">
2:TAACAGGATTAGCAGAGCGAGG (Martin Langecker et al.<span class="ref-sup"><a href="#desref-2">[2]</a></span>)
</p>
<p class="item">
3:GGAACTTCAGCCCAACTAACATTTT
</p>
<p class="noindent-paragraph">
These are different in the length and in sequence. The sequence of cholesterol modified oligos are perfectly complementary to the above three sequences, and their 5' ends are modified with a cholesterol.
</p>
<p class="paragraph">
To achieve oligomerization, the OCK has binding site by means of hybridization. Two pairs of sequences were used for hybridization. Both sequences are according to previous work (Shawn M. Douglas, et al. <span class="ref-sup"><a href="#desref-4">[4]</a></span>). These are derived from aptamer sequence, one is TE17, the other is sgc8c (and the complementary strands to these, so two pairs). These sequences were chosen because it is considered that these sequences don't prevent the folding of scaffold. The sequences are:
</p>
<p class="item">1:TCTAACCGTACAGTATTTTCCCGGCGGCGCAGCAGTTAGA TT(sgc8c aptamer + TT)
</p>
<p class="item">2:TT CAGCACCCAGTCAGAAGCAGGTGTTCGGAGTTTTGTATTGCGTAGCTG(TT+ TE17 aptamer )
</p>
<p class="noindent-paragraph">
Designed structures have either the aptamer sequences (1, 2) or the two complementary strands (1, 2). When two structures with different pairs are mixed and hybridization happens, these structures hence bind each other through two binding sites. Two types of binding sites were designed to test whether the direction of connection can be controlled. One type of binding site uses staples sticking out from the ends of scaffolds, the other uses staples from side of OCK.
</p>
<figure>
<center>
<img src="http://openwetware.org/images/5/5a/Des_2_2_4thparagraph-Todai.png" width="300px" height="300px" >
<figcaption style="position:relative;left:-20px">
Fluorescent materials are equipped
<br>by streptavidin-biotin interaction.
</figcaption>
</center>
</figure>
<br>
<p class="paragraph">
To detect the cylinder piercing membrane, biotin modified staple strands (biotin-oligo) are attached at the bottom of OCK and hybridized with complementally strands labeled with fluorescence. Strept-avidins (SA) encapsulated in the liposome could bind to the OCK, and only the biotin-oligo penetrating liposome could bind to the SA, which can be detected by the gel shift assay.
</p>
<br>
<p class="paragraph">
From the results of experiments with “Cylinder” we will decide our final design.
</p>
</article>
<br>
<br>
<br>
<!--References-->
<article>
<h1 class="title"><a name="References"> References</a></h1>
<br>
<div>
<div class="reference-title">
<a name="desref-1">
[1] The Structure of DNA−Liposome Complexes
</a>
</div>
<div class="reference-author">
Danilo D. Lasic,Helmut Strey, Mark C. A. Stuart, Rudolf Podgornik, and Peter M. Frederik
</div>
<div class="reference-journal">
Journal of the American Chemical Society 1997 119 (4), 832-833
</div>
</div>
<br>
<div>
<div class="reference-title">
<a name="desref-2">
[2] Synthetic Lipid Membrane Channels Formed by Designed DNA Nanostructures
</a>
</div>
<div class="reference-author">
Martin Langecker, Vera Arnaut, Thomas G. Martin, Jonathan List, Stephan Renner, Michael Mayer, Hendrik Dietz, and Friedrich C. Simmel
</div>
<div class="reference-journal">
Science 16 November 2012: 338 (6109), 932-936. [DOI:10.1126/science.1225624]
</div>
</div>
<br>
<div>
<div class="reference-title">
<a name="desref-3">
[3] Multifactorial Modulation of Binding and Dissociation Kinetics on Two-Dimensional DNA Nanostructures
</a>
</div>
<div class="reference-author">
Alexander Johnson-Buck, Jeanette Nangreave, Shuoxing Jiang, Hao Yan, and Nils G. Walter
</div>
<div class="reference-journal" style="font-style:italic;">
Nano Letters 2013 13 (6), 2754-2759
</div>
</div>
<br>
<div>
<div class="reference-title">
<a name="desref-4">
[4] A logic-gated nanorobot for targeted transport of molecular payloads.
</a>
</div>
<div class="reference-author">
S. M. Douglas, I. Bachelet, G. M. Church
</div>
<div class="reference-journal">
Science 335, 831 (2012)
</div>
</div>
</article> <br> <br> <br> <br> <br> <br> <br> <br>
<footer style="position:relative;left:400px"> <small> Copyright © Todai nanORFEVRE, all rights reserved. </small> </footer> </body> </html>
