CTR:Notebook/PIRE/2014/04/24: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
Line 1: Line 1:
{|{{table}} width="800"
{|{{table}} width="800"
|-
|-
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> PIRE RAD Library Preps</span>
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> PIRE RAD Library Preps - Troubleshooting</span>
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|-
|-
| colspan="2"|
| colspan="2"|
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
==RAD Library Prep - Troubleshooting==
==Overview==
After sequencing the first plate of RAD libraries, it appeared as though the P1 adapter and barcodes were missing. The hypothesis is that the P1 adapters failed to ligate and instead the P2 adapter ligated to both ends. When trying to selectively amplify the fragments with the P1 adapters, we actually amplified fragments with two P2 adapters.  This could happen because the P2 adapter contains binding sites for both the P1 adapter primer (underlined) and the P2 adapter primer (bold).
After sequencing the first plate of RAD libraries, it appeared as though the P1 adapter and barcodes were missing. The hypothesis is that the P1 adapters failed to ligate and instead the P2 adapter ligated to both ends. When trying to selectively amplify the fragments with the P1 adapters, we actually amplified fragments with two P2 adapters.  This could happen because the P2 adapter contains binding sites for both the P1 adapter primer (underlined) and the P2 adapter primer (bold).


Revision as of 17:06, 10 June 2014

PIRE RAD Library Preps - Troubleshooting <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Overview

After sequencing the first plate of RAD libraries, it appeared as though the P1 adapter and barcodes were missing. The hypothesis is that the P1 adapters failed to ligate and instead the P2 adapter ligated to both ends. When trying to selectively amplify the fragments with the P1 adapters, we actually amplified fragments with two P2 adapters. This could happen because the P2 adapter contains binding sites for both the P1 adapter primer (underlined) and the P2 adapter primer (bold).

P1 adapter primer: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'

P2 adapter primer: 5' CAAGCAGAAGACGGCATACGA 3'

P2 adapter: 5' CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T 3'

Normally this would not happen because the match between the P1 adapter and the P1 primer is much better than the match between the P2 adapter and the P1 primer.

To test if this is in fact what happened, we first ordered a new, more specific P1 adapter primer that should not bind to the P2 adapter:

5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G 3'

We then performed the following tests to 1) verify that the P2 adapter ligated to both ends and 2) verify that the old P1 adapter did not ligate.

Verification of P2 adapter ligation to both ends

To see if the P2 adapter could have ligated to both ends, we start the RAD protocol from the sonication step, skipping the P1 adapter ligation step. If the end product amplifies with the old P1 primer, then only the P2 adapter could have ligated.

  1. Start with approximately 1700 ng DNA and sonicate in Bioruptor for 8 cycles of 15 seconds on, 90 seconds off (high power).
  2. Transfer 50 μL of sheared DNA to new PCR tube and add 5.5 μL water.
  3. Perform steps for blunt end repair, adapter ligation, size selection, and PCR following the RAD protocol. The old P1 adapter primer is used in the PCR step, not the new one.
  4. Run a gel using 1 μL of unamplified library template and 5 μL of PCR product.

The PCR product is brighter than the template, suggesting successful amplification. Therefore, we can conclude that the P2 adapter did indeed ligate to both ends and was successfully amplified by the old P1 primer.

Verification of absence of P1 adapter

We use leftover DNA library template from the failed first plate and re-do the final PCR step using the new P1 primer. Because it is more specific to the P1 adapter, the primer should not amplify segments with P2 adapters ligated to both ends. We expect to see amplification only if the P1 adapter successfully ligated.

The first lane contains 1 μL of template and the second lane contains 5 μL of PCR product. Because there is no apparent amplification in the PCR product, we conclude that the P1 adapter did not ligate.

Retrieved from "https://openwetware.org/mediawiki/index.php?title=CTR:Notebook/PIRE/2014/04/24&oldid=797289"