Cfrench:primerlist

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 134: Line 134:
===Primers for ''Escherichia coli lac''' genes===
===Primers for ''Escherichia coli lac''' genes===
 +
 +
'''laczf1''' cctt'''tctaga'''ggaggaaacagctatgacc
 +
*Date: 11 Jul 06
 +
*Purpose: amplification of ''lacZ''' from ''E. coli'' BS with its native ribosome binding site.
 +
*Restriction sites: XbaI only
 +
*Notes:
 +
 +
'''laczf2''' ggtctagagctcatgttatatcccg
 +
*Date: 18 July 2006
 +
*Purpose:
 +
*Restriction sites: XbaI
 +
*Notes:
 +
 +
'''laczf3''' gggtcgacaggtttcccgactg
 +
*Date: 18 July 2006
 +
*Purpose:
 +
*Restriction sites:
 +
*Notes:
 +
 +
'''laczr1''' aaggctgcagcggccgctactagtatcactccagccagctttc
 +
*Date: 11 July 2006
 +
*Purpose:
 +
*Restriction sites: PstI, NotI, SpeI
 +
*Notes: Designed to produce a truncated version of ''lacZ'' with stop codon TGA at position 77, but also produces minor product truncated with stop codon at position 137, reason unclear.
 +
 +
'''Eclacr2''' gttactagtgtgaaattgttatccgc
 +
*Date: 21 August 2006
 +
*Purpose:
 +
*Restriction sites: SpeI
 +
*Notes:
 +
 +
 +
===Primers for chromogenic reporter genes===
===Primers for chromogenic reporter genes===
 +
 +
===Template===
 +
'''primer'''
 +
*Date
 +
*Purpose:
 +
*Restriction sites:
 +
*Notes:
 +
[[French_Lab|Back to Main Page]]
[[French_Lab|Back to Main Page]]

Revision as of 12:42, 16 August 2007

Contents

Catalog of primers

Primers for iGEM2007 flavours/fragrances project

echf1 aat gaattc gcggccgc t tctag atg agc aaa tac gaa ggt c

  • Purpose: forward primer for ech (ferA) coding sequence from Ps. fluorescens NCIMB 9046.
  • Restriction sites: EcoRI, XbaI
  • Notes: no ribosome binding site included.

echr1 ct actagt a tta tta gcg ttt ata ggc ttg cag c

  • Purpose: reverse primer for ech (ferA) coding sequence from Ps. fluorescens NCIMB 9046.
  • Restriction sites: SpeI only.
  • Notes: replaces TGA stop codon with TAA TAA. Also replaces PstI site in coding sequence with silent mutation.

fcsf1 aat gaattc gcggccgc t tctag atg cgc tcc ctg gaa ccc

  • Purpose: forward primer for fcs (ferB) coding sequence from Ps. fluorescens NCIMB 9046.
  • Restriction sites: EcoRI, XbaI
  • Notes: no ribosome binding site included.

fcsr1 ct actagt a tta tta cgg ttt ggg ccc ggc ac

  • Purpose: reverse primer for fcs (ferB) coding sequence from Ps. fluorescens NCIMB 9046.
  • Restriction sites: SpeI only.
  • Notes: replaces TGA stop codon with TAA TAA.

Ms_COMTf1 aat gaattc gcggccgc t tctag atg ggt tca aca ggt gaa ac

  • Purpose: forward primer for caffeate O-methltransferase coding sequence from Medicago sativa (alfalfa).
  • Restriction sites: EcoRI, XbaI.
  • Notes: eukaryotic gene, no ribosome binding site.

Ms_COMTr1 ct actagt a tta tta aac ctt ctt aag aaa ctc c

  • Purpose: reverse primer for caffeate O-methltransferase coding sequence from Medicago sativa (alfalfa).
  • Restriction sites: SpeI only (NOT PstI).
  • Notes: adds TAA TAA stop codons.

echf2 atc gagctc acacc cagaa caaga gc

  • Date: 9 August 2007.
  • Purpose: amplify ech from Pseudomonas with rbs and some surrounding DNA.
  • Restriction sites: SacI
  • Notes: this was made because no product was obtained with echf1 and echr1.

echr2 tt actagt atcgg gaaca cgttc aagc

  • Date: 9 August 2007.
  • Purpose: amplify ech from Pseudomonas with rbs and some surrounding DNA.
  • Restriction sites: SpeI
  • Notes: this was made because no product was obtained with echf1 and echr1.

fcsf2 gtg gagctc actga agaac agggc gtg

  • Date: 9 August 2007.
  • Purpose: amplify fcs from Pseudomonas with rbs and some surrounding DNA.
  • Restriction sites: SacI
  • Notes: this was made because no product was obtained with fcsf1 and fcsr1.

fcsr2 aa actagt atgcc gtgac agcaa atagg

  • Date: 9 August 2007.
  • Purpose: amplify fcs from Pseudomonas with rbs and some surrounding DNA.
  • Restriction sites: SpeI
  • Notes: this was made because no product was obtained with fcsf1 and fcsr1.

sam5f1 at gaattc gcggccgc t tctag atg acc atc acg tca cct g

  • Date: 9 August 2007.
  • Purpose: amplify sam5 from Saccharothrix espanaensis.
  • Restriction sites: EcoRI, NotI, XbaI (not SacI!)
  • Notes: coding sequence only, no ribosome binding site.

sam5r1 ct actagt a tta tta ggt gcc ggg gtt gat cag

  • Date: 9 August 2007.
  • Purpose: amplify sam5 from Saccharothrix espanaensis.
  • Restriction sites: SpeI (not PstI!)
  • Notes: coding sequence modified to end with TAA TAA.

sam8f1 at gaattc gcggccgc t tctag atg acg cag gtc gtg gaa cg

  • Date: 9 August 2007.
  • Purpose: amplify sam8 from Saccharothrix espanaensis.
  • Restriction sites: EcoRI, NotI, XbaI (not SacI!)
  • Notes: coding sequence only, no ribosome binding site.

sam8r1 ct actagt a tta tta tcc gaa atc ctt ccc gtc

  • Date: 9 August 2007.
  • Purpose: amplify sa85 from Saccharothrix espanaensis.
  • Restriction sites: SpeI (not PstI!)
  • Notes: coding sequence modified to end with TAA TAA.


Primers for iGEM2007 bioswitches project

revPlacf1 tcta gagctc tgtgtgaaattgttatccg

  • Purpose: forward biobrick primer for making a reverse lac promoter.
  • Restriction sites: XbaI (probably won't cut as right at end), SacI

revPlacr1 ct actagt a caatacgcaaaccgcctc

  • Purpose: reverse biobrick primer for making a reverse lac promoter.
  • Restriction sites: SpeI only.

Primers for working with biobricks

pSB1A3f1 tccttagctttcgctaagg

  • Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof.
  • Restriction sites: none (but amplification products will have full biobrick prefix)

pSB1A3r1 agggtggtgacaccttgc

  • Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof.
  • Restriction sites: none (but amplification products will have full biobrick suffix)

pSB1A2insf1 cgctaaggatgatttctgg

  • Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof.
  • Restriction sites: none (but amplification products will have full biobrick prefix)
  • Notes: excellent resuts for sequencing.

pSB1A2insr1 gtcagtgagcgaggaagc

  • Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof.
  • Restriction sites: none (but amplification products will have full biobrick suffix)
  • Notes: excellent resuts for sequencing.

bbinsertf1 attc gcggccgc t tctag

  • Purpose: sequencing or amplification of any biobrick insert
  • Restriction sites: only NotI, but amplification product will have XbaI, and SacI if present.
  • Note: gives good results for sequencing, but pSB1A2insf1 is better.

bbinsertr1 tgcag cggccgc t actag

  • Purpose: sequencing or amplification of any biobrick insert
  • Restriction sites: only NotI, but amplification product will have SpeI.
  • Note: usually not very good results for sequencing.

bbvectorf1 ag t actag ta gcggccg ctgc

  • Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick suffix and amplifies vector region.
  • Restriction sites: SpeI, NotI; amplification product will also have PstI.

bbvectr1 cctt gagctc taga a gcggccgc gaattc

  • Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick prefix and amplifies vector region.
  • Restriction sites: SacI, XbaI, EcoRI.


Primers for 'Bacillobrick' project

Primers for Bacillus subtilis ureABC genes

Primers for Escherichia coli lac' genes

laczf1 cctttctagaggaggaaacagctatgacc

  • Date: 11 Jul 06
  • Purpose: amplification of lacZ' from E. coli BS with its native ribosome binding site.
  • Restriction sites: XbaI only
  • Notes:

laczf2 ggtctagagctcatgttatatcccg

  • Date: 18 July 2006
  • Purpose:
  • Restriction sites: XbaI
  • Notes:

laczf3 gggtcgacaggtttcccgactg

  • Date: 18 July 2006
  • Purpose:
  • Restriction sites:
  • Notes:

laczr1 aaggctgcagcggccgctactagtatcactccagccagctttc

  • Date: 11 July 2006
  • Purpose:
  • Restriction sites: PstI, NotI, SpeI
  • Notes: Designed to produce a truncated version of lacZ with stop codon TGA at position 77, but also produces minor product truncated with stop codon at position 137, reason unclear.

Eclacr2 gttactagtgtgaaattgttatccgc

  • Date: 21 August 2006
  • Purpose:
  • Restriction sites: SpeI
  • Notes:



Primers for chromogenic reporter genes

Template

primer

  • Date
  • Purpose:
  • Restriction sites:
  • Notes:


Back to Main Page

Personal tools