Cfrench:primerlist
From OpenWetWare
Current revision (05:01, 18 October 2011) (view source) |
|||
| (21 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
==Catalog of primers== | ==Catalog of primers== | ||
| + | |||
| + | ===Template=== | ||
| + | '''primer''' | ||
| + | *Date: | ||
| + | *Purpose: | ||
| + | *Restriction sites: | ||
| + | *Notes: | ||
| + | |||
| + | ===Primers for working with pT7-7=== | ||
| + | |||
| + | '''T7seqf1''' taatacgactcactataggg | ||
| + | *Date: June 08 | ||
| + | *Purpose: sequencing inserts in pT7-7 (forward) | ||
| + | *Restriction sites: none | ||
| + | *Notes: works well. | ||
| + | |||
| + | '''T7vectf1''' tagagtcgacctgcagcccaagc | ||
| + | *Date: June 08 | ||
| + | *Purpose: Fusion PCR for tricky insertions into pT7-7 | ||
| + | *Restriction sites: SalI, PstI | ||
| + | *Notes: use with insert reverse primer. The fusion PCR product will also contain the HindIII and ClaI sites from the end of the pT7-7 multi-cloning site, but not the EcoRI, SmaI, BamHI or XbaI sites which precede the SalI site. | ||
| + | |||
| + | '''T77r''' atgtatatctccttcttaaagttaaac | ||
| + | *Date: July 08 | ||
| + | *Purpose: editing or blunt ended insetion strategies for pT7-7 | ||
| + | *Restriction sites: none | ||
| + | *Notes: makes a blunt ended PCR product including the first half of the NdeI site. Thus it can be used with a blunt ended forward primer starting with ATG, such as a Babel primer (see below), so can be used to insert a BioBrick coding sequence into pT7-7 for expression studies. Worked OK for Sahreena. | ||
| + | |||
| + | '''T7MCSF1''' gctagaattcgcgcccgg | ||
| + | *Date: 26 Sep 2005 | ||
| + | *Purpose: Fusion PCR to introduce inserts into pT7-7 | ||
| + | *Restriction sites: EcoRI, but the product will have all of the pT7-7 restriction sites other than NdeI. | ||
| + | *Notes: since this primer binds well back in the MCS, the initial digest for the first ligation should be with NdeI alone. | ||
| + | |||
| + | ===Primers for working with biobricks=== | ||
| + | '''pSB1A3f1''' tccttagctttcgctaagg | ||
| + | *Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof. | ||
| + | *Restriction sites: none (but amplification products will have full biobrick prefix) | ||
| + | |||
| + | '''pSB1A3r1''' agggtggtgacaccttgc | ||
| + | *Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof. | ||
| + | *Restriction sites: none (but amplification products will have full biobrick suffix) | ||
| + | |||
| + | '''pSB1A2insf1''' cgctaaggatgatttctgg | ||
| + | *Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof. | ||
| + | *Restriction sites: none (but amplification products will have full biobrick prefix) | ||
| + | *Notes: excellent resuts for sequencing. | ||
| + | |||
| + | '''pSB1A2insr1''' gtcagtgagcgaggaagc | ||
| + | *Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof. | ||
| + | *Restriction sites: none (but amplification products will have full biobrick suffix) | ||
| + | *Notes: excellent resuts for sequencing. | ||
| + | |||
| + | '''pSB1A2insf2''' aataggcgtatcacgagg | ||
| + | *Date: | ||
| + | *Purpose: sequencing BioBrick inserts in pSB1A2. | ||
| + | *Restriction sites: none. | ||
| + | *Notes: This primer is set further back than pSB1A2insf1 (above), so that the sequence always includes the BioBricks restriction sites, which are usually not readable when pSB1A2insf1 is used. | ||
| + | |||
| + | '''pSB1A2insr2''' tttgagtgagctgatacc | ||
| + | *Date: | ||
| + | *Purpose: sequencing BioBrick inserts in pSB1A2. | ||
| + | *Restriction sites: none. | ||
| + | *Notes: This primer is set further back than pSB1A2insr1 (above), so that the sequence always includes the BioBricks restriction sites, which are usually not readable when pSB1A2insr1 is used. | ||
| + | |||
| + | '''bbinsertf1''' attc gcggccgc t tctag | ||
| + | *Purpose: sequencing or amplification of any biobrick insert | ||
| + | *Restriction sites: only NotI, but amplification product will have XbaI, and SacI if present. | ||
| + | *Note: gives good results for sequencing, but pSB1A2insf1 is better. | ||
| + | |||
| + | '''bbinsertr1''' tgcag cggccgc t actag | ||
| + | *Purpose: sequencing or amplification of any biobrick insert | ||
| + | *Restriction sites: only NotI, but amplification product will have SpeI. | ||
| + | *Note: usually not very good results for sequencing. | ||
| + | |||
| + | '''bbvectorf1''' ag t actag ta gcggccg ctgc | ||
| + | *Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick suffix and amplifies vector region. | ||
| + | *Restriction sites: SpeI, NotI; amplification product will also have PstI. | ||
| + | |||
| + | '''bbvectr1''' cctt gagctc taga a gcggccgc gaattc | ||
| + | *Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick prefix and amplifies vector region. | ||
| + | *Restriction sites: SacI, XbaI, EcoRI. | ||
| + | |||
| + | '''pTG262f1''' gttgtgtggaattgtgagc | ||
| + | *Date: 13 sep 07 | ||
| + | *Purpose: sequencing of inserts in pTG262 and derivatives thereof. | ||
| + | *Restriction sites: none | ||
| + | *Notes: on more detailed analysis of the pTG262 sequence, it was found that this primer actually binds in the lac promoter region. It is therefore also useful for sequencing inserts in pBluescript SK+ and Babel vectors derived therefrom. Works well. | ||
| + | |||
| + | '''pTG262r1''' ggttttcccagtcacgacg | ||
| + | *Date: 13 sep 07 | ||
| + | *Purpose: sequencing of inserts in pTG262 and derivatives thereof. | ||
| + | *Restriction sites: none | ||
| + | *Notes: on more detailed analysis of the pTG262 sequence, it was found that this primer actually binds in the lacZ' coding region. It is therefore also useful for sequencing inserts in pBluescript SK+ and Babel vectors derived therefrom. Works well. | ||
| + | |||
| + | '''stdvectf1 aka babelf1''' tactagtagcggccgctgcagattcactggccgtcgttttac | ||
| + | *Date: 2 Oct 2007 | ||
| + | *Purpose: making a BioBrick vector for blunt-ended ligation of PCR products (Babel vector) | ||
| + | *Restriction sites: SpeI, NotI, PstI (full standard BioBrick suffix) | ||
| + | *Notes: designed to use pBluescript SK+ as template. Works. | ||
| + | |||
| + | '''stdvectr1 aka babelr1''' ctctagaagcggccgcgaattccgtaatcatggtcatagc | ||
| + | *Date: 2 Oct 2007 | ||
| + | *Purpose: making a blunt-ended cloning vector for standard BioBricks | ||
| + | *Restriction sites: XbaI, NotI, EcoRI (full BioBrick prefix) | ||
| + | *Notes: designed to use pBluescript SK+ as template. Works. | ||
| + | |||
| + | '''babelr2''' ctagtacctcctctctagaagcggccgcgaattc | ||
| + | *Date: | ||
| + | *Purpose: making a blunt-ended (babel) cloning vector for coding sequence BioBricks that automatically adds a ribosome binding site and scar. | ||
| + | *Restriction sites: XbaI, NotI, EcoRI | ||
| + | *Notes: cannot use pBluescriptSK+ as template: designed to use Babel1 linear or circular DNA as template. Works. | ||
| + | |||
| + | '''babelr3''' ctagaagcggccgcgaattcgtaatcatggtcatagc | ||
| + | *Date: | ||
| + | *Purpose: making a blunt-ended (babel) cloning vector for coding sequence BioBricks without adding a ribosome binding site. | ||
| + | *Restriction sites: XbaI, NotI, EcoRI | ||
| + | *Notes: designed to use pBluescript SK+ as template. Not thoroughly tested at time of writing. | ||
| + | |||
| + | '''salxba1''' tcgactctagaagcggccgcgaattc | ||
| + | *Date: 18 July 2006 | ||
| + | *Purpose: converting pT7-7 to a BioBrick vector by adding the proper restriction sites. | ||
| + | *Restriction sites: XbaI, NotI, EcoRI | ||
| + | *Notes: used with its partner below to generate a double stranded linker which was ligated into pT7-7. | ||
| + | |||
| + | '''xbasal1''' ctaggaattcgcggccgcttctagag | ||
| + | *Date: 18 July 2006 | ||
| + | *Purpose: converting pT7-7 to a BioBrick vector by adding the proper restriction sites. | ||
| + | *Restriction sites: XbaI, NotI, EcoRI | ||
| + | *Notes: used with its partner above to generate a double stranded linker which was ligated into pT7-7. | ||
| + | |||
| + | '''rbs2r''' cgc t actagt a cctcctt gagctctaga a gcggccgc gaattc aagg | ||
| + | *Date: 13 Feb 2007 | ||
| + | *Purpose: synthetic ribosome binding site for addition to coding sequence BioBricks. | ||
| + | *Restriction sites: SpeI, SacI, XbaI, NotI, EcoRI | ||
| + | *Notes: designed to be used with its partner to make a synthetic ribosome binding site which could be digested with EcoRI/SpeI and ligated to coding sequence BioBricks. The ligation could be transformed as usual or used as template for a fusion PCR reaction using primer rbs2fclon1 with an insert or vector reverse primer. | ||
| + | |||
| + | '''rbs2fclon1''' cgct tctagagctc aaggagg tactag atg | ||
| + | *Date: 20 Feb 2007 | ||
| + | *Purpose: fusion PCR following ligation of a synthetic ribosome binding site (see above) to a coding sequence BioBrick. | ||
| + | *Restriction sites: XbaI, SacI | ||
| + | *Notes: can clone SacI/SpeI if the reverse primer lacks a PstI site (assuming that the coding sequence contains no SacI sites). Alternatively, can use a suitable vector reverse primer with XbaI site to generate the whole construct for self-ligation, or a primer such as pSB1A2insr1 to generate a fragment with the PstI site. | ||
| + | |||
| + | '''pSBNX3insf2''' aaat aggcg tatca cgagg c | ||
| + | *Date: 12 August 2010 | ||
| + | *Purpose: forward sequencing of inserts in any pSB plasmid with a 3 ending (such as pSB1C3). | ||
| + | *Restriction sites: none, but amplification products will have complete prefix. | ||
| + | *Notes: also binds to pSB1A2 in a similar place. Annealing temperature 62.9 C. | ||
| + | |||
| + | '''pSBNX3insr2''' cagt gagcg aggaa gcctg c | ||
| + | *Date: 12 August 2010 | ||
| + | *Purpose: reverse sequencing of inserts in any pSB plasmid with a 3 ending (such as pSB1C3). | ||
| + | *Restriction sites: none, but amplification products will have complete suffix. | ||
| + | *Notes: also binds to pSB1A2, but much closer to insertion site (overlaps PstI site) so not good for sequencing. | ||
| + | ===Primers for ''Escherichia coli lac'' genes=== | ||
| + | |||
| + | '''laczf1''' cctt tctaga gg aggaaacagct atg acc | ||
| + | *Date: 11 Jul 06 | ||
| + | *Purpose: amplification of ''lacZ''' from ''E. coli'' BS with its native ribosome binding site (actually the rbs is slightly improved by adding 2 extra G residues at the start). | ||
| + | *Restriction sites: XbaI only | ||
| + | *Notes: Worked fine. | ||
| + | |||
| + | '''laczf2''' gg tctaga gctc atgt tata tccc g | ||
| + | *Date: 18 July 2006 | ||
| + | *Purpose: Construction of Edinbrick1 (BBa_J33207). | ||
| + | *Restriction sites: XbaI, SacI | ||
| + | *Notes: Puts ''lacZ'' into pSB1A2 with a SacI site overlapping the XbaI site. This allows other PCR products to be cloned in replacing the ''lacZ'' marker gene after digestion with SacI and SpeI, meaning that primers can be much shorter than if a full prefix or suffix was required. Products are fully compliant biobricks. The complementary part of this primer starts about 370 bases upstream of the start codon, so the full promoter region is present. | ||
| + | |||
| + | '''laczf3''' gg gtcgac aggt ttccc gact g | ||
| + | *Date: 18 July 2006 | ||
| + | *Purpose: Construction of a biobrick vector based on pT7-7. | ||
| + | *Restriction sites: SalI | ||
| + | *Notes: This vector was never completed. The complementary part of this primer starts 30 bases upstream of the CAP binding site, about 150 bases upstream of the start codon, so the promoter region is also included. | ||
| + | |||
| + | '''laczr1''' aagg ctgcag cggccgc t actagt a tca ctc cag cca gct ttc | ||
| + | *Date: 11 July 2006 | ||
| + | *Purpose: Designed to produce a truncated version of ''lacZ'' with stop codon TGA at position 77. | ||
| + | *Restriction sites: PstI, NotI, SpeI | ||
| + | *Notes: Also produces minor product truncated with stop codon at position 137, reason unclear. Still works fine though. | ||
| + | |||
| + | '''Eclacr2''' gtt actagt gtgaaattgttatccgc | ||
| + | *Date: 21 August 2006 | ||
| + | *Purpose: to amplify the lac promoter region alone without lacZ or its rbs. | ||
| + | *Restriction sites: SpeI | ||
| + | *Notes: Don't remember whether this was used. | ||
| + | |||
| + | '''XWlaczZf1''' cctt tctag atg acc atg att acg gat tc | ||
| + | *Date: 27 Feb 2007 | ||
| + | *Purpose: amplification of ''lacZ'' coding sequence (without rbs) from ''E. coli''. | ||
| + | *Restriction sites: XbaI | ||
| + | *Notes: | ||
| + | |||
| + | '''XWlacZr1''' aagg ctgcag cggccgc t actagt a tta tta ctc cag cca gct ttc c | ||
| + | *Date: 27 Feb 2007 | ||
| + | *Purpose: amplification of ''lacZ'' coding sequence with TAA TAA double stop codon introduced after codon 76, to comply with Registry recommendations for coding sequence biobricks. | ||
| + | *Restriction sites: PstI, NotI, SpeI | ||
| + | *Notes: | ||
| + | |||
| + | '''eclacyf1''' ggcgagctctgcccgtatttcgcgtaag | ||
| + | *Date: 1 Sep 2006 | ||
| + | *Purpose: testing for presence of intact ''lacY'' in ''E. coli'' strains. | ||
| + | *Restriction sites: SacI. | ||
| + | *Notes: Also could be used to clone ''lacY'' as a biobrick using SacI/SpeI sites in an Edinbrick vector. | ||
| + | |||
| + | '''eclacyr1''' gatactagtcgcgccgcatccgacattg | ||
| + | *Date: 1 Sep 2006 | ||
| + | *Purpose: as above. | ||
| + | *Restriction sites: SpeI | ||
| + | *Notes: as above. | ||
| + | |||
| + | '''bbtagf1''' gga tctaga ctagt gagc gcaa cgca atta atg | ||
| + | *Date: 22 June 2007 | ||
| + | *Purpose: amplify lacZ' with rbs using a reverse primer such as lacZr1 with a full biobrick suffix, in order to make a cleavable ''lacZ'' tag to facilitate combining biobricks. | ||
| + | *Restriction sites: XbaI, SpeI | ||
| + | *Notes: Complementary part lies at the start of the CAP-binding site, about 128 bases upstream of the start codon, so the promoter region is present. Generated a good PCR product and was cloned in a suitable vector, but later I realised that cleavage at this SpeI site would generate a non-compliant biobrick lacking one of the required residues in the suffix (the T before the SpeI site). Therefore I designed primer bbtagf2, see below. | ||
| + | |||
| + | '''bbtagf2''' ggatctagaggatct actagt gagcgcaacgcaattaatg | ||
| + | *Date: | ||
| + | *Purpose: making a cleavable 3' lacZ' tag for assembling BioBricks: see bbtagf1 above. | ||
| + | *Restriction sites: SpeI | ||
| + | *Notes: this project was never completed: not sure whether it would have worked. | ||
| + | |||
| + | '''t7tagf1''' ggc aat catatg ttgc ccgt ctca ctgg | ||
| + | *Date: 22 June 2007 | ||
| + | *Purpose: Amplify ''lacZ'' for insertion into pT7-7 as a removable tag so that Sahreena could insert PCR products into pT7-7 and have a way of telling which clones had the insert by blue white selection. | ||
| + | *Restriction sites: NdeI | ||
| + | *Notes: The complementary region starts about 255 bases upstream of the ''lacZ'' start codon, so the promoter is included, and it will work in a strain like JM109 rather than relying on the T7 promoter in the vector. Worked fine. Insertion is between NdeI and EcoRI so that EcoRI and all other sites in the MCS are available for cloning. | ||
| + | |||
| + | '''t7tagr1''' gaa gaat tca ctc cag cca gct ttc c | ||
| + | *Date: 22 June 2007 | ||
| + | *Purpose: Amplify ''lacZ'' for insertion into pT7-7 as a removable tag so that Sahreena could insert PCR products into pT7-7 and have a way of telling which clones had the insert by blue white selection. A TGA stop codon (overlaps the EcoRI site) is introduced at codon 77 of ''lacZ''. | ||
| + | *Restriction sites: EcoRI | ||
| + | *Notes: Worked fine. | ||
| + | |||
| + | ===Primers for chromogenic reporter genes=== | ||
| + | |||
| + | '''PpxylEf2''' ct gagctc atga acta tgaa gagg tg | ||
| + | *Date: | ||
| + | *Purpose: amplification of ''xylE'' encoding catechol-2,3-dioxygenase from TOL plasmid pWW0 (subclone kindly provided by Prof. Peter Williams) | ||
| + | *Restriction sites: SacI | ||
| + | *Notes: Used to make J33204, aka Edinbrick 2 vector. Detect XylE by adding a drop of 10 mM catechol to patches; yellow colour develops rapidly. Works much better on patches than on primary colonies from transformation. | ||
| + | |||
| + | '''PpxylEr2''' ta actagt a ccgg acca tcag gtc | ||
| + | *Date: | ||
| + | *Purpose: amplification of ''xylE'' encoding catechol-2,3-dioxygenase from TOL plasmid pWW0 (subclone kindly provided by Prof. Peter Williams) | ||
| + | *Restriction sites: SpeI | ||
| + | *Notes: Used to make J33204, aka Edinbrick 2 vector. Detect XylE by adding a drop of 10 mM catechol to patches; yellow colour develops rapidly. Works much better on patches than on primary colonies from transformation. | ||
| + | |||
| + | '''dsRedf1''' atggcttcctccgaagac | ||
| + | *Date: | ||
| + | *Purpose: making a blunt-ended DsRed PCR product to test Babel cloning vectors (see above). | ||
| + | *Restriction sites: none. | ||
| + | *Notes: worked well. Used Registry RFP BioBricks as template. | ||
| + | |||
| + | '''dsRedr1''' ttattaagcaccggtggag | ||
| + | *Date: | ||
| + | *Purpose: making a blunt-ended DsRed PCR product to test Babel cloning vectors (see above). | ||
| + | *Restriction sites: none. | ||
| + | *Notes: worked well. Used Registry RFP BioBricks as template. | ||
| + | |||
| + | ===Primers for heavy metal sensing components=== | ||
| + | |||
| + | '''Ecarsf1''' cctt tctaga g ccaa ctca aaat tcac | ||
| + | *Date: | ||
| + | *Purpose: amplification of ''ars'' promoter and ''arsR'' gene from ''E. coli'' K12. | ||
| + | *Restriction sites: XbaI | ||
| + | *Notes: Amplification successful. Used to make J33201. | ||
| + | |||
| + | '''Ecarsr1''' aagg ctgcag cggccgc t actagt a cccg gata aaac acat c | ||
| + | *Date: | ||
| + | *Purpose: amplification of ''ars'' promoter and ''arsR'' gene from ''E. coli'' K12. | ||
| + | *Restriction sites: PstI, NotI, SpeI | ||
| + | *Notes: Amplification successful. Used to make J33201. | ||
| + | |||
| + | '''Bsarsf2''' at gagctc cgtt gctg tagt agc | ||
| + | *Date: | ||
| + | *Purpose: amplification of ''ars'' promoter and ''arsR'' gene from ''B. subtilis'' 168. | ||
| + | *Restriction sites: XbaI | ||
| + | *Notes: Amplification successful. Used to make J33206. | ||
| + | |||
| + | '''Bsarsr2''' aa actagt ttag cagc aatc tcct tc | ||
| + | *Date: | ||
| + | *Purpose: amplification of ''ars'' promoter and ''arsR'' gene from ''B. subtilis'' 168. | ||
| + | *Restriction sites: SpeI | ||
| + | *Notes: Amplification successful. Used to make J33206. However, due to an error in design, this primer does not produce a compliant biobrick since it is missing the A after the SpeI site. To get around this, we added another biobrick to get a compliant 3' end. Also note that constructs using this as a control system did not show good regulation in ''E. coli'' in our experiments, in contrast to previous experience with this promoter using other reporter genes such as ''xylE''. | ||
| + | |||
| + | '''PzntAf1''' tcta gagctc tctg cgtttgtt gg | ||
| + | *Date: 9 August 2007 | ||
| + | *Purpose: amplification of the ''zntA'' promoter region from ''E. coli'' K12. | ||
| + | *Restriction sites: XbaI (probably won't cut as right at end), SacI | ||
| + | *Notes: amplification successful. | ||
| + | |||
| + | '''PzntAr1''' ct actagt atta accg aagg atac actc | ||
| + | *Date: 9 August 2007 | ||
| + | *Purpose: amplification of the ''zntA'' promoter region from ''E. coli'' K12. | ||
| + | *Restriction sites: SpeI | ||
| + | *Notes: amplification successful. | ||
| + | |||
| + | '''yhdMf1''' aga gaattc gcggccgc t tctag atg tat cgc att ggt gag c | ||
| + | *Date: 9 August 2007 | ||
| + | *Purpose: amplification of ''yhdM'' (aka ''copR'', ''cueR'') encoding copper-dependent MerR-like activator protein from ''E. coli'' K12. | ||
| + | *Restriction sites: EcoRI, NotI, XbaI | ||
| + | *Notes: amplification successful. | ||
| + | |||
| + | '''yhdMr1''' ct actagt a tta tta aca acc act ctt aac gcc | ||
| + | *Date: 9 August 2007 | ||
| + | *Purpose: amplification of ''yhdM'' (aka ''copR'', ''cueR'') encoding copper-dependent MerR-like activator protein from ''E. coli'' K12. | ||
| + | *Restriction sites: SpeI | ||
| + | *Notes: introduces TAA TAA double stop codon to comply with Registry recommendations for coding sequence biobricks. Amplification successful. | ||
===Primers for iGEM2007 flavours/fragrances project=== | ===Primers for iGEM2007 flavours/fragrances project=== | ||
| Line 62: | Line 371: | ||
*Restriction sites: EcoRI, NotI, XbaI (not SacI!) | *Restriction sites: EcoRI, NotI, XbaI (not SacI!) | ||
*Notes: coding sequence only, no ribosome binding site. | *Notes: coding sequence only, no ribosome binding site. | ||
| + | |||
| + | '''sam5f2''' tc gaattc gcggccgc t tctaga g acgg agaa gcag cgaa atg | ||
| + | *Date: 21 Sep 07 | ||
| + | *Purpose: amplifies ''sam5'' with native ribosome binding site region. | ||
| + | *Restriction sites: EcoRI, NotI, XbaI (not SacI!) | ||
| + | *Notes: the ''sam5'' gene has one internal site each for SacI and PstI. Amplification OK from plasmid DNA. | ||
'''sam5r1''' ct actagt a tta tta ggt gcc ggg gtt gat cag | '''sam5r1''' ct actagt a tta tta ggt gcc ggg gtt gat cag | ||
| Line 74: | Line 389: | ||
*Restriction sites: EcoRI, NotI, XbaI (not SacI!) | *Restriction sites: EcoRI, NotI, XbaI (not SacI!) | ||
*Notes: coding sequence only, no ribosome binding site. | *Notes: coding sequence only, no ribosome binding site. | ||
| + | |||
| + | '''sam8f2''' tc gaattc gcggccgc t tctaga g gagg ttgg gaca agat gac | ||
| + | *Date: 21 Sep 07 | ||
| + | *Purpose: amplify ''sam8'' with native ribosome binding site region. | ||
| + | *Restriction sites: EcoRI, NotI, XbaI (not SacI!) | ||
| + | *Notes: coding sequence contains an internal SacI site. Amplification OK from plasmid DNA. | ||
'''sam8r1''' ct actagt a tta tta tcc gaa atc ctt ccc gtc | '''sam8r1''' ct actagt a tta tta tcc gaa atc ctt ccc gtc | ||
*Date: 9 August 2007. | *Date: 9 August 2007. | ||
| - | *Purpose: amplify '' | + | *Purpose: amplify ''sam8'' from ''Saccharothrix espanaensis''. |
*Restriction sites: SpeI (not PstI!) | *Restriction sites: SpeI (not PstI!) | ||
*Notes: coding sequence modified to end with TAA TAA. | *Notes: coding sequence modified to end with TAA TAA. | ||
| Line 92: | Line 413: | ||
*Restriction sites: SpeI | *Restriction sites: SpeI | ||
*Notes: amplification from cell suspension was successful. Product size 997 bp. | *Notes: amplification from cell suspension was successful. Product size 997 bp. | ||
| + | |||
| + | '''crtEr2''' cgt actagt a tta tta act gac ggc agc gag | ||
| + | *Date: 4 Oct 07 | ||
| + | *Purpose: amplifying ''crtE'' from ''Pantoea ananatis'' leaving a BioBrick-compliant end | ||
| + | *Restriction sites: SpeI (not PstI!) | ||
| + | *Notes: leaves TAA TAA stop codon. Worked fine. | ||
'''crtYf1''' cag gagctc ttaa gtgg gagc ggct atg | '''crtYf1''' cag gagctc ttaa gtgg gagc ggct atg | ||
| Line 104: | Line 431: | ||
*Restriction sites: SpeI | *Restriction sites: SpeI | ||
*Notes: amplification from cell suspension was successful. Product size 1202 bp. | *Notes: amplification from cell suspension was successful. Product size 1202 bp. | ||
| + | |||
| + | '''crtYr2''' cgt actagt a tta tta acg atg agt cgt cat aat g | ||
| + | *Date: 4 Oct 07 | ||
| + | *Purpose: amplifies ''crtY'' from ''Pantoea ananatis'' leaving a BioBrick compliant end. | ||
| + | *Restriction sites: SpeI (not PstI!) | ||
| + | *Notes: leaves TAA TAA at end. Worked. | ||
'''crtIf1''' tga gagctc atcg ttaa agag cgac | '''crtIf1''' tga gagctc atcg ttaa agag cgac | ||
| Line 116: | Line 449: | ||
*Restriction sites: SpeI | *Restriction sites: SpeI | ||
*Notes: amplification from cell suspension was successful. Note that ''crtI'' contains two PstI sites. Product size 2477 bp. | *Notes: amplification from cell suspension was successful. Note that ''crtI'' contains two PstI sites. Product size 2477 bp. | ||
| + | |||
| + | '''crtBr2''' cgt actagt a tta tta gag cgg gcg ctg cca g | ||
| + | *Date: 4 Oct 07 | ||
| + | *Purpose: amplifies ''crtIB'' from ''Pantoea ananatis'' with a BioBrick compliant end. | ||
| + | *Restriction sites: SpeI (not PstI!) | ||
| + | *Notes: leaves TAA TAA at end of ''crtB''. Note that ''crtI'' contains 2 PstI sites. Worked. | ||
'''crtZf1''' aga gagctc tacc ggag aaat tatg | '''crtZf1''' aga gagctc tacc ggag aaat tatg | ||
| Line 128: | Line 467: | ||
*Restriction sites: SpeI | *Restriction sites: SpeI | ||
*Notes: amplification from cell suspension was successful. Note that ''crtZ'' is encoded on the opposite strand to ''crtEXYBI''. Product size 565 bp. | *Notes: amplification from cell suspension was successful. Note that ''crtZ'' is encoded on the opposite strand to ''crtEXYBI''. Product size 565 bp. | ||
| + | |||
| + | '''crtZr2''' cgt actagt a tta tta ctt ccc gga tgc ggg | ||
| + | *Date: 4 Oct 07 | ||
| + | *Purpose: amplifies ''crtZ'' from ''Pantoea ananatis'' with a BioBrick compliant end. | ||
| + | *Restriction sites: SpeI (not PstI!) | ||
| + | *Notes: leaves TAA TAA at end. Worked. | ||
'''crtopr1''' cc actagt ggag tact tccc gatg | '''crtopr1''' cc actagt ggag tact tccc gatg | ||
| Line 144: | Line 489: | ||
*Purpose: reverse biobrick primer for making a reverse ''lac'' promoter. | *Purpose: reverse biobrick primer for making a reverse ''lac'' promoter. | ||
*Restriction sites: SpeI only. | *Restriction sites: SpeI only. | ||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
| - | |||
===Primers for 'Bacillobrick' project=== | ===Primers for 'Bacillobrick' project=== | ||
| Line 193: | Line 500: | ||
===Primers for ''Bacillus subtilis ureABC'' genes=== | ===Primers for ''Bacillus subtilis ureABC'' genes=== | ||
| - | + | '''Bsuref1''' ga gagctc cgca aatt cgta gtag c | |
| + | *Date: | ||
| + | *Purpose: Amplification of urease gene cluster ''ureABC'' from ''B. subtilis'' 168. | ||
| + | *Restriction sites: SacI | ||
| + | *Notes: Worked. | ||
| - | ''' | + | '''Bsurer1''' ct ggatcc atgg gttt tgtg cacc g |
| - | *Date: | + | *Date: |
| - | *Purpose: | + | *Purpose: Amplification of urease gene cluster ''ureABC'' from ''B. subtilis'' 168. |
| - | *Restriction sites: | + | *Restriction sites: BamHI |
| - | *Notes: | + | *Notes: The urease gene cluster contained one EcoRI and one SpeI site, so could not be initially cloned as a biobrick, so it was cloned SacI/BamHI into pBluescript SK+ to use as a template for mutagenesis to remove the offending sites. |
| - | ''' | + | '''Bsure1r1''' tcc tctaga gaga ccgt tttc tgct ctc |
| - | *Date: | + | *Date: |
| - | *Purpose: | + | *Purpose: elimination of an SpeI site in ''ureABC'' by amplifying the gene cluster in two overlapping parts, converting one of the SpeI sites to an XbaI site, ligating together to generate a non-cleavable fusion site. |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
*Restriction sites: XbaI | *Restriction sites: XbaI | ||
| - | *Notes: | + | *Notes: used with Bsure2f1 (see below) |
| - | ''' | + | '''Bsure2f1''' aaa acgg tctc actagt gg |
| - | *Date: | + | *Date: |
| - | *Purpose: | + | *Purpose: elimination of an SpeI site in ''ureABC'' by amplifying the gene cluster in two overlapping parts, converting one of the SpeI sites to an XbaI site, ligating together to generate a non-cleavable fusion site. |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
*Restriction sites: SpeI | *Restriction sites: SpeI | ||
| - | *Notes: | + | *Notes: used with Bsure1r1 (see above) |
| + | '''Bsure2r1''' cat ctcgag cttg ctca gctt tctg | ||
| + | *Date: | ||
| + | *Purpose: mutating an EcoRI site in ''ureABC'' by amplifying the gene cluster as two overlapping fragments, mutating out the EcoRI and introducing an XhoI which could be used to ligate the fragments together. | ||
| + | *Restriction sites: XhoI | ||
| + | *Notes: used with Bsure3f2 (see below) | ||
| + | '''Bsure3f2''' aag ctcgag atga agct gaac tcgg cttt g | ||
| + | *Date: | ||
| + | *Purpose: mutating an EcoRI site in ''ureABC'' by amplifying the gene cluster as two overlapping fragments, mutating out the EcoRI and introducing an XhoI which could be used to ligate the fragments together. | ||
| + | *Restriction sites: XhoI | ||
| + | *Notes: used with Bsure2r1 (see above) | ||
| - | + | '''Bsure3r2''' tac actagt tttg tgca ccgt tttt ag | |
| - | + | *Date: | |
| - | + | *Purpose: converting the final ''ureABC'' product to a biobrick by adding the 3' SpeI site. | |
| - | + | *Restriction sites: SpeI | |
| - | ''' | + | *Notes: the alert reader will notice that this would not produce a compliant biobrick since it is missing the A basee after the SpeI site. Oops. |
| - | *Date | + | |
| - | *Purpose: | + | |
| - | *Restriction sites: | + | |
| - | *Notes: | + | |
[[French_Lab|Back to Main Page]] | [[French_Lab|Back to Main Page]] | ||
Current revision
Catalog of primers
Template
primer
- Date:
- Purpose:
- Restriction sites:
- Notes:
Primers for working with pT7-7
T7seqf1 taatacgactcactataggg
- Date: June 08
- Purpose: sequencing inserts in pT7-7 (forward)
- Restriction sites: none
- Notes: works well.
T7vectf1 tagagtcgacctgcagcccaagc
- Date: June 08
- Purpose: Fusion PCR for tricky insertions into pT7-7
- Restriction sites: SalI, PstI
- Notes: use with insert reverse primer. The fusion PCR product will also contain the HindIII and ClaI sites from the end of the pT7-7 multi-cloning site, but not the EcoRI, SmaI, BamHI or XbaI sites which precede the SalI site.
T77r atgtatatctccttcttaaagttaaac
- Date: July 08
- Purpose: editing or blunt ended insetion strategies for pT7-7
- Restriction sites: none
- Notes: makes a blunt ended PCR product including the first half of the NdeI site. Thus it can be used with a blunt ended forward primer starting with ATG, such as a Babel primer (see below), so can be used to insert a BioBrick coding sequence into pT7-7 for expression studies. Worked OK for Sahreena.
T7MCSF1 gctagaattcgcgcccgg
- Date: 26 Sep 2005
- Purpose: Fusion PCR to introduce inserts into pT7-7
- Restriction sites: EcoRI, but the product will have all of the pT7-7 restriction sites other than NdeI.
- Notes: since this primer binds well back in the MCS, the initial digest for the first ligation should be with NdeI alone.
Primers for working with biobricks
pSB1A3f1 tccttagctttcgctaagg
- Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof.
- Restriction sites: none (but amplification products will have full biobrick prefix)
pSB1A3r1 agggtggtgacaccttgc
- Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof.
- Restriction sites: none (but amplification products will have full biobrick suffix)
pSB1A2insf1 cgctaaggatgatttctgg
- Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof.
- Restriction sites: none (but amplification products will have full biobrick prefix)
- Notes: excellent resuts for sequencing.
pSB1A2insr1 gtcagtgagcgaggaagc
- Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof.
- Restriction sites: none (but amplification products will have full biobrick suffix)
- Notes: excellent resuts for sequencing.
pSB1A2insf2 aataggcgtatcacgagg
- Date:
- Purpose: sequencing BioBrick inserts in pSB1A2.
- Restriction sites: none.
- Notes: This primer is set further back than pSB1A2insf1 (above), so that the sequence always includes the BioBricks restriction sites, which are usually not readable when pSB1A2insf1 is used.
pSB1A2insr2 tttgagtgagctgatacc
- Date:
- Purpose: sequencing BioBrick inserts in pSB1A2.
- Restriction sites: none.
- Notes: This primer is set further back than pSB1A2insr1 (above), so that the sequence always includes the BioBricks restriction sites, which are usually not readable when pSB1A2insr1 is used.
bbinsertf1 attc gcggccgc t tctag
- Purpose: sequencing or amplification of any biobrick insert
- Restriction sites: only NotI, but amplification product will have XbaI, and SacI if present.
- Note: gives good results for sequencing, but pSB1A2insf1 is better.
bbinsertr1 tgcag cggccgc t actag
- Purpose: sequencing or amplification of any biobrick insert
- Restriction sites: only NotI, but amplification product will have SpeI.
- Note: usually not very good results for sequencing.
bbvectorf1 ag t actag ta gcggccg ctgc
- Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick suffix and amplifies vector region.
- Restriction sites: SpeI, NotI; amplification product will also have PstI.
bbvectr1 cctt gagctc taga a gcggccgc gaattc
- Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick prefix and amplifies vector region.
- Restriction sites: SacI, XbaI, EcoRI.
pTG262f1 gttgtgtggaattgtgagc
- Date: 13 sep 07
- Purpose: sequencing of inserts in pTG262 and derivatives thereof.
- Restriction sites: none
- Notes: on more detailed analysis of the pTG262 sequence, it was found that this primer actually binds in the lac promoter region. It is therefore also useful for sequencing inserts in pBluescript SK+ and Babel vectors derived therefrom. Works well.
pTG262r1 ggttttcccagtcacgacg
- Date: 13 sep 07
- Purpose: sequencing of inserts in pTG262 and derivatives thereof.
- Restriction sites: none
- Notes: on more detailed analysis of the pTG262 sequence, it was found that this primer actually binds in the lacZ' coding region. It is therefore also useful for sequencing inserts in pBluescript SK+ and Babel vectors derived therefrom. Works well.
stdvectf1 aka babelf1 tactagtagcggccgctgcagattcactggccgtcgttttac
- Date: 2 Oct 2007
- Purpose: making a BioBrick vector for blunt-ended ligation of PCR products (Babel vector)
- Restriction sites: SpeI, NotI, PstI (full standard BioBrick suffix)
- Notes: designed to use pBluescript SK+ as template. Works.
stdvectr1 aka babelr1 ctctagaagcggccgcgaattccgtaatcatggtcatagc
- Date: 2 Oct 2007
- Purpose: making a blunt-ended cloning vector for standard BioBricks
- Restriction sites: XbaI, NotI, EcoRI (full BioBrick prefix)
- Notes: designed to use pBluescript SK+ as template. Works.
babelr2 ctagtacctcctctctagaagcggccgcgaattc
- Date:
- Purpose: making a blunt-ended (babel) cloning vector for coding sequence BioBricks that automatically adds a ribosome binding site and scar.
- Restriction sites: XbaI, NotI, EcoRI
- Notes: cannot use pBluescriptSK+ as template: designed to use Babel1 linear or circular DNA as template. Works.
babelr3 ctagaagcggccgcgaattcgtaatcatggtcatagc
- Date:
- Purpose: making a blunt-ended (babel) cloning vector for coding sequence BioBricks without adding a ribosome binding site.
- Restriction sites: XbaI, NotI, EcoRI
- Notes: designed to use pBluescript SK+ as template. Not thoroughly tested at time of writing.
salxba1 tcgactctagaagcggccgcgaattc
- Date: 18 July 2006
- Purpose: converting pT7-7 to a BioBrick vector by adding the proper restriction sites.
- Restriction sites: XbaI, NotI, EcoRI
- Notes: used with its partner below to generate a double stranded linker which was ligated into pT7-7.
xbasal1 ctaggaattcgcggccgcttctagag
- Date: 18 July 2006
- Purpose: converting pT7-7 to a BioBrick vector by adding the proper restriction sites.
- Restriction sites: XbaI, NotI, EcoRI
- Notes: used with its partner above to generate a double stranded linker which was ligated into pT7-7.
rbs2r cgc t actagt a cctcctt gagctctaga a gcggccgc gaattc aagg
- Date: 13 Feb 2007
- Purpose: synthetic ribosome binding site for addition to coding sequence BioBricks.
- Restriction sites: SpeI, SacI, XbaI, NotI, EcoRI
- Notes: designed to be used with its partner to make a synthetic ribosome binding site which could be digested with EcoRI/SpeI and ligated to coding sequence BioBricks. The ligation could be transformed as usual or used as template for a fusion PCR reaction using primer rbs2fclon1 with an insert or vector reverse primer.
rbs2fclon1 cgct tctagagctc aaggagg tactag atg
- Date: 20 Feb 2007
- Purpose: fusion PCR following ligation of a synthetic ribosome binding site (see above) to a coding sequence BioBrick.
- Restriction sites: XbaI, SacI
- Notes: can clone SacI/SpeI if the reverse primer lacks a PstI site (assuming that the coding sequence contains no SacI sites). Alternatively, can use a suitable vector reverse primer with XbaI site to generate the whole construct for self-ligation, or a primer such as pSB1A2insr1 to generate a fragment with the PstI site.
pSBNX3insf2 aaat aggcg tatca cgagg c
- Date: 12 August 2010
- Purpose: forward sequencing of inserts in any pSB plasmid with a 3 ending (such as pSB1C3).
- Restriction sites: none, but amplification products will have complete prefix.
- Notes: also binds to pSB1A2 in a similar place. Annealing temperature 62.9 C.
pSBNX3insr2 cagt gagcg aggaa gcctg c
- Date: 12 August 2010
- Purpose: reverse sequencing of inserts in any pSB plasmid with a 3 ending (such as pSB1C3).
- Restriction sites: none, but amplification products will have complete suffix.
- Notes: also binds to pSB1A2, but much closer to insertion site (overlaps PstI site) so not good for sequencing.
Primers for Escherichia coli lac genes
laczf1 cctt tctaga gg aggaaacagct atg acc
- Date: 11 Jul 06
- Purpose: amplification of lacZ' from E. coli BS with its native ribosome binding site (actually the rbs is slightly improved by adding 2 extra G residues at the start).
- Restriction sites: XbaI only
- Notes: Worked fine.
laczf2 gg tctaga gctc atgt tata tccc g
- Date: 18 July 2006
- Purpose: Construction of Edinbrick1 (BBa_J33207).
- Restriction sites: XbaI, SacI
- Notes: Puts lacZ into pSB1A2 with a SacI site overlapping the XbaI site. This allows other PCR products to be cloned in replacing the lacZ marker gene after digestion with SacI and SpeI, meaning that primers can be much shorter than if a full prefix or suffix was required. Products are fully compliant biobricks. The complementary part of this primer starts about 370 bases upstream of the start codon, so the full promoter region is present.
laczf3 gg gtcgac aggt ttccc gact g
- Date: 18 July 2006
- Purpose: Construction of a biobrick vector based on pT7-7.
- Restriction sites: SalI
- Notes: This vector was never completed. The complementary part of this primer starts 30 bases upstream of the CAP binding site, about 150 bases upstream of the start codon, so the promoter region is also included.
laczr1 aagg ctgcag cggccgc t actagt a tca ctc cag cca gct ttc
- Date: 11 July 2006
- Purpose: Designed to produce a truncated version of lacZ with stop codon TGA at position 77.
- Restriction sites: PstI, NotI, SpeI
- Notes: Also produces minor product truncated with stop codon at position 137, reason unclear. Still works fine though.
Eclacr2 gtt actagt gtgaaattgttatccgc
- Date: 21 August 2006
- Purpose: to amplify the lac promoter region alone without lacZ or its rbs.
- Restriction sites: SpeI
- Notes: Don't remember whether this was used.
XWlaczZf1 cctt tctag atg acc atg att acg gat tc
- Date: 27 Feb 2007
- Purpose: amplification of lacZ coding sequence (without rbs) from E. coli.
- Restriction sites: XbaI
- Notes:
XWlacZr1 aagg ctgcag cggccgc t actagt a tta tta ctc cag cca gct ttc c
- Date: 27 Feb 2007
- Purpose: amplification of lacZ coding sequence with TAA TAA double stop codon introduced after codon 76, to comply with Registry recommendations for coding sequence biobricks.
- Restriction sites: PstI, NotI, SpeI
- Notes:
eclacyf1 ggcgagctctgcccgtatttcgcgtaag
- Date: 1 Sep 2006
- Purpose: testing for presence of intact lacY in E. coli strains.
- Restriction sites: SacI.
- Notes: Also could be used to clone lacY as a biobrick using SacI/SpeI sites in an Edinbrick vector.
eclacyr1 gatactagtcgcgccgcatccgacattg
- Date: 1 Sep 2006
- Purpose: as above.
- Restriction sites: SpeI
- Notes: as above.
bbtagf1 gga tctaga ctagt gagc gcaa cgca atta atg
- Date: 22 June 2007
- Purpose: amplify lacZ' with rbs using a reverse primer such as lacZr1 with a full biobrick suffix, in order to make a cleavable lacZ tag to facilitate combining biobricks.
- Restriction sites: XbaI, SpeI
- Notes: Complementary part lies at the start of the CAP-binding site, about 128 bases upstream of the start codon, so the promoter region is present. Generated a good PCR product and was cloned in a suitable vector, but later I realised that cleavage at this SpeI site would generate a non-compliant biobrick lacking one of the required residues in the suffix (the T before the SpeI site). Therefore I designed primer bbtagf2, see below.
bbtagf2 ggatctagaggatct actagt gagcgcaacgcaattaatg
- Date:
- Purpose: making a cleavable 3' lacZ' tag for assembling BioBricks: see bbtagf1 above.
- Restriction sites: SpeI
- Notes: this project was never completed: not sure whether it would have worked.
t7tagf1 ggc aat catatg ttgc ccgt ctca ctgg
- Date: 22 June 2007
- Purpose: Amplify lacZ for insertion into pT7-7 as a removable tag so that Sahreena could insert PCR products into pT7-7 and have a way of telling which clones had the insert by blue white selection.
- Restriction sites: NdeI
- Notes: The complementary region starts about 255 bases upstream of the lacZ start codon, so the promoter is included, and it will work in a strain like JM109 rather than relying on the T7 promoter in the vector. Worked fine. Insertion is between NdeI and EcoRI so that EcoRI and all other sites in the MCS are available for cloning.
t7tagr1 gaa gaat tca ctc cag cca gct ttc c
- Date: 22 June 2007
- Purpose: Amplify lacZ for insertion into pT7-7 as a removable tag so that Sahreena could insert PCR products into pT7-7 and have a way of telling which clones had the insert by blue white selection. A TGA stop codon (overlaps the EcoRI site) is introduced at codon 77 of lacZ.
- Restriction sites: EcoRI
- Notes: Worked fine.
Primers for chromogenic reporter genes
PpxylEf2 ct gagctc atga acta tgaa gagg tg
- Date:
- Purpose: amplification of xylE encoding catechol-2,3-dioxygenase from TOL plasmid pWW0 (subclone kindly provided by Prof. Peter Williams)
- Restriction sites: SacI
- Notes: Used to make J33204, aka Edinbrick 2 vector. Detect XylE by adding a drop of 10 mM catechol to patches; yellow colour develops rapidly. Works much better on patches than on primary colonies from transformation.
PpxylEr2 ta actagt a ccgg acca tcag gtc
- Date:
- Purpose: amplification of xylE encoding catechol-2,3-dioxygenase from TOL plasmid pWW0 (subclone kindly provided by Prof. Peter Williams)
- Restriction sites: SpeI
- Notes: Used to make J33204, aka Edinbrick 2 vector. Detect XylE by adding a drop of 10 mM catechol to patches; yellow colour develops rapidly. Works much better on patches than on primary colonies from transformation.
dsRedf1 atggcttcctccgaagac
- Date:
- Purpose: making a blunt-ended DsRed PCR product to test Babel cloning vectors (see above).
- Restriction sites: none.
- Notes: worked well. Used Registry RFP BioBricks as template.
dsRedr1 ttattaagcaccggtggag
- Date:
- Purpose: making a blunt-ended DsRed PCR product to test Babel cloning vectors (see above).
- Restriction sites: none.
- Notes: worked well. Used Registry RFP BioBricks as template.
Primers for heavy metal sensing components
Ecarsf1 cctt tctaga g ccaa ctca aaat tcac
- Date:
- Purpose: amplification of ars promoter and arsR gene from E. coli K12.
- Restriction sites: XbaI
- Notes: Amplification successful. Used to make J33201.
Ecarsr1 aagg ctgcag cggccgc t actagt a cccg gata aaac acat c
- Date:
- Purpose: amplification of ars promoter and arsR gene from E. coli K12.
- Restriction sites: PstI, NotI, SpeI
- Notes: Amplification successful. Used to make J33201.
Bsarsf2 at gagctc cgtt gctg tagt agc
- Date:
- Purpose: amplification of ars promoter and arsR gene from B. subtilis 168.
- Restriction sites: XbaI
- Notes: Amplification successful. Used to make J33206.
Bsarsr2 aa actagt ttag cagc aatc tcct tc
- Date:
- Purpose: amplification of ars promoter and arsR gene from B. subtilis 168.
- Restriction sites: SpeI
- Notes: Amplification successful. Used to make J33206. However, due to an error in design, this primer does not produce a compliant biobrick since it is missing the A after the SpeI site. To get around this, we added another biobrick to get a compliant 3' end. Also note that constructs using this as a control system did not show good regulation in E. coli in our experiments, in contrast to previous experience with this promoter using other reporter genes such as xylE.
PzntAf1 tcta gagctc tctg cgtttgtt gg
- Date: 9 August 2007
- Purpose: amplification of the zntA promoter region from E. coli K12.
- Restriction sites: XbaI (probably won't cut as right at end), SacI
- Notes: amplification successful.
PzntAr1 ct actagt atta accg aagg atac actc
- Date: 9 August 2007
- Purpose: amplification of the zntA promoter region from E. coli K12.
- Restriction sites: SpeI
- Notes: amplification successful.
yhdMf1 aga gaattc gcggccgc t tctag atg tat cgc att ggt gag c
- Date: 9 August 2007
- Purpose: amplification of yhdM (aka copR, cueR) encoding copper-dependent MerR-like activator protein from E. coli K12.
- Restriction sites: EcoRI, NotI, XbaI
- Notes: amplification successful.
yhdMr1 ct actagt a tta tta aca acc act ctt aac gcc
- Date: 9 August 2007
- Purpose: amplification of yhdM (aka copR, cueR) encoding copper-dependent MerR-like activator protein from E. coli K12.
- Restriction sites: SpeI
- Notes: introduces TAA TAA double stop codon to comply with Registry recommendations for coding sequence biobricks. Amplification successful.
Primers for iGEM2007 flavours/fragrances project
echf1 aat gaattc gcggccgc t tctag atg agc aaa tac gaa ggt c
- Purpose: forward primer for ech (ferA) coding sequence from Ps. fluorescens NCIMB 9046.
- Restriction sites: EcoRI, XbaI
- Notes: no ribosome binding site included.
echr1 ct actagt a tta tta gcg ttt ata ggc ttg cag c
- Purpose: reverse primer for ech (ferA) coding sequence from Ps. fluorescens NCIMB 9046.
- Restriction sites: SpeI only.
- Notes: replaces TGA stop codon with TAA TAA. Also replaces PstI site in coding sequence with silent mutation.
fcsf1 aat gaattc gcggccgc t tctag atg cgc tcc ctg gaa ccc
- Purpose: forward primer for fcs (ferB) coding sequence from Ps. fluorescens NCIMB 9046.
- Restriction sites: EcoRI, XbaI
- Notes: no ribosome binding site included.
fcsr1 ct actagt a tta tta cgg ttt ggg ccc ggc ac
- Purpose: reverse primer for fcs (ferB) coding sequence from Ps. fluorescens NCIMB 9046.
- Restriction sites: SpeI only.
- Notes: replaces TGA stop codon with TAA TAA.
Ms_COMTf1 aat gaattc gcggccgc t tctag atg ggt tca aca ggt gaa ac
- Purpose: forward primer for caffeate O-methltransferase coding sequence from Medicago sativa (alfalfa).
- Restriction sites: EcoRI, XbaI.
- Notes: eukaryotic gene, no ribosome binding site.
Ms_COMTr1 ct actagt a tta tta aac ctt ctt aag aaa ctc c
- Purpose: reverse primer for caffeate O-methltransferase coding sequence from Medicago sativa (alfalfa).
- Restriction sites: SpeI only (NOT PstI).
- Notes: adds TAA TAA stop codons.
echf2 atc gagctc acacc cagaa caaga gc
- Date: 9 August 2007.
- Purpose: amplify ech from Pseudomonas with rbs and some surrounding DNA.
- Restriction sites: SacI
- Notes: this was made because no product was obtained with echf1 and echr1.
echr2 tt actagt atcgg gaaca cgttc aagc
- Date: 9 August 2007.
- Purpose: amplify ech from Pseudomonas with rbs and some surrounding DNA.
- Restriction sites: SpeI
- Notes: this was made because no product was obtained with echf1 and echr1.
fcsf2 gtg gagctc actga agaac agggc gtg
- Date: 9 August 2007.
- Purpose: amplify fcs from Pseudomonas with rbs and some surrounding DNA.
- Restriction sites: SacI
- Notes: this was made because no product was obtained with fcsf1 and fcsr1.
fcsr2 aa actagt atgcc gtgac agcaa atagg
- Date: 9 August 2007.
- Purpose: amplify fcs from Pseudomonas with rbs and some surrounding DNA.
- Restriction sites: SpeI
- Notes: this was made because no product was obtained with fcsf1 and fcsr1.
sam5f1 at gaattc gcggccgc t tctag atg acc atc acg tca cct g
- Date: 9 August 2007.
- Purpose: amplify sam5 from Saccharothrix espanaensis.
- Restriction sites: EcoRI, NotI, XbaI (not SacI!)
- Notes: coding sequence only, no ribosome binding site.
sam5f2 tc gaattc gcggccgc t tctaga g acgg agaa gcag cgaa atg
- Date: 21 Sep 07
- Purpose: amplifies sam5 with native ribosome binding site region.
- Restriction sites: EcoRI, NotI, XbaI (not SacI!)
- Notes: the sam5 gene has one internal site each for SacI and PstI. Amplification OK from plasmid DNA.
sam5r1 ct actagt a tta tta ggt gcc ggg gtt gat cag
- Date: 9 August 2007.
- Purpose: amplify sam5 from Saccharothrix espanaensis.
- Restriction sites: SpeI (not PstI!)
- Notes: coding sequence modified to end with TAA TAA.
sam8f1 at gaattc gcggccgc t tctag atg acg cag gtc gtg gaa cg
- Date: 9 August 2007.
- Purpose: amplify sam8 from Saccharothrix espanaensis.
- Restriction sites: EcoRI, NotI, XbaI (not SacI!)
- Notes: coding sequence only, no ribosome binding site.
sam8f2 tc gaattc gcggccgc t tctaga g gagg ttgg gaca agat gac
- Date: 21 Sep 07
- Purpose: amplify sam8 with native ribosome binding site region.
- Restriction sites: EcoRI, NotI, XbaI (not SacI!)
- Notes: coding sequence contains an internal SacI site. Amplification OK from plasmid DNA.
sam8r1 ct actagt a tta tta tcc gaa atc ctt ccc gtc
- Date: 9 August 2007.
- Purpose: amplify sam8 from Saccharothrix espanaensis.
- Restriction sites: SpeI (not PstI!)
- Notes: coding sequence modified to end with TAA TAA.
crtEf1 gca gagctc gcgt tgcc gtaa atgt atc
- Date: 13 August 2007
- Purpose: amplification of crtE from Pantoea ananatis ATCC 19321 (DSM 30080)
- Restriction sites: SacI
- Notes: amplification from cell suspension was successful.
crtEr1 aa actagt gcga tcgc cgcg aaat g
- Date: 13 August 2007
- Purpose: amplification of crtE from Pantoea ananatis ATCC 19321 (DSM 30080)
- Restriction sites: SpeI
- Notes: amplification from cell suspension was successful. Product size 997 bp.
crtEr2 cgt actagt a tta tta act gac ggc agc gag
- Date: 4 Oct 07
- Purpose: amplifying crtE from Pantoea ananatis leaving a BioBrick-compliant end
- Restriction sites: SpeI (not PstI!)
- Notes: leaves TAA TAA stop codon. Worked fine.
crtYf1 cag gagctc ttaa gtgg gagc ggct atg
- Date: 13 August 2007
- Purpose: amplification of crtY from Pantoea ananatis ATCC 19321 (DSM 30080)
- Restriction sites: SacI
- Notes: amplification from cell suspension was successful.
crtYr1 ac actagt tggt ttca tgta gtcg
- Date: 13 August 2007
- Purpose: amplification of crtY from Pantoea ananatis ATCC 19321 (DSM 30080)
- Restriction sites: SpeI
- Notes: amplification from cell suspension was successful. Product size 1202 bp.
crtYr2 cgt actagt a tta tta acg atg agt cgt cat aat g
- Date: 4 Oct 07
- Purpose: amplifies crtY from Pantoea ananatis leaving a BioBrick compliant end.
- Restriction sites: SpeI (not PstI!)
- Notes: leaves TAA TAA at end. Worked.
crtIf1 tga gagctc atcg ttaa agag cgac
- Date: 13 August 2007
- Purpose: amplification of crtIB from Pantoea ananatis ATCC 19321 (DSM 30080)
- Restriction sites: SacI
- Notes: amplification from cell suspension was successful. Note that crtI contains two PstI sites.
crtBr1 gc actagt caaa actt cagg cgac
- Date: 13 August 2007
- Purpose: amplification of crtIB from Pantoea ananatis ATCC 19321 (DSM 30080)
- Restriction sites: SpeI
- Notes: amplification from cell suspension was successful. Note that crtI contains two PstI sites. Product size 2477 bp.
crtBr2 cgt actagt a tta tta gag cgg gcg ctg cca g
- Date: 4 Oct 07
- Purpose: amplifies crtIB from Pantoea ananatis with a BioBrick compliant end.
- Restriction sites: SpeI (not PstI!)
- Notes: leaves TAA TAA at end of crtB. Note that crtI contains 2 PstI sites. Worked.
crtZf1 aga gagctc tacc ggag aaat tatg
- Date: 13 August 2007
- Purpose: amplification of crtZ from Pantoea ananatis ATCC 19321 (DSM 30080)
- Restriction sites: SacI
- Notes: amplification from cell suspension was successful. Note that crtZ is encoded on the opposite strand to crtEXYBI.
crtZr1 cc actagt cagg ccct tact tccc
- Date: 13 August 2007
- Purpose: amplification of crtZ from Pantoea ananatis ATCC 19321 (DSM 30080)
- Restriction sites: SpeI
- Notes: amplification from cell suspension was successful. Note that crtZ is encoded on the opposite strand to crtEXYBI. Product size 565 bp.
crtZr2 cgt actagt a tta tta ctt ccc gga tgc ggg
- Date: 4 Oct 07
- Purpose: amplifies crtZ from Pantoea ananatis with a BioBrick compliant end.
- Restriction sites: SpeI (not PstI!)
- Notes: leaves TAA TAA at end. Worked.
crtopr1 cc actagt ggag tact tccc gatg
- Date: 13 August 2007
- Purpose: amplification of crt region (with primer crtEf1) from Pantoea ananatis ATCC 19321 (DSM 30080)
- Restriction sites: SpeI
- Notes: amplification from cell suspension was successful. Note that crtZ is encoded on the opposite strand to crtEXYBI, so reverse primer crtZr1 could not be used to amplify the whole region. (crtZf1 would have given a product but with SacI sites at both ends.) Product size 6490 bp.
Primers for iGEM2007 bioswitches project
revPlacf1 tcta gagctc tgtgtgaaattgttatccg
- Purpose: forward biobrick primer for making a reverse lac promoter.
- Restriction sites: XbaI (probably won't cut as right at end), SacI
revPlacr1 ct actagt a caatacgcaaaccgcctc
- Purpose: reverse biobrick primer for making a reverse lac promoter.
- Restriction sites: SpeI only.
Primers for 'Bacillobrick' project
specf3 aac gagctc aacg aggt gaaa tcat g
- Date: 22 June 2007
- Purpose: amplification of spectinomycin resistance gene from plasmid pVK168 (Patrick Piggot, Temple U).
- Restriction sites: SacI
- Notes: A product was obtained (in contrast to primers specf1 and specf2, which never produced a product; these two primers were much further upstream, in the hope of including the promoter region, whereas specf3 just includes the rbs; this suggests that there is some problem with the sequence data I was given). However, numerous attempts to clone the PCR product in pGemT-easy and Edinbricks 1, 2 and 3 were unsuccessful. The reason for this is unclear. At this date (21 Aug 2007) this product has not been successfully cloned.
Primers for Bacillus subtilis ureABC genes
Bsuref1 ga gagctc cgca aatt cgta gtag c
- Date:
- Purpose: Amplification of urease gene cluster ureABC from B. subtilis 168.
- Restriction sites: SacI
- Notes: Worked.
Bsurer1 ct ggatcc atgg gttt tgtg cacc g
- Date:
- Purpose: Amplification of urease gene cluster ureABC from B. subtilis 168.
- Restriction sites: BamHI
- Notes: The urease gene cluster contained one EcoRI and one SpeI site, so could not be initially cloned as a biobrick, so it was cloned SacI/BamHI into pBluescript SK+ to use as a template for mutagenesis to remove the offending sites.
Bsure1r1 tcc tctaga gaga ccgt tttc tgct ctc
- Date:
- Purpose: elimination of an SpeI site in ureABC by amplifying the gene cluster in two overlapping parts, converting one of the SpeI sites to an XbaI site, ligating together to generate a non-cleavable fusion site.
- Restriction sites: XbaI
- Notes: used with Bsure2f1 (see below)
Bsure2f1 aaa acgg tctc actagt gg
- Date:
- Purpose: elimination of an SpeI site in ureABC by amplifying the gene cluster in two overlapping parts, converting one of the SpeI sites to an XbaI site, ligating together to generate a non-cleavable fusion site.
- Restriction sites: SpeI
- Notes: used with Bsure1r1 (see above)
Bsure2r1 cat ctcgag cttg ctca gctt tctg
- Date:
- Purpose: mutating an EcoRI site in ureABC by amplifying the gene cluster as two overlapping fragments, mutating out the EcoRI and introducing an XhoI which could be used to ligate the fragments together.
- Restriction sites: XhoI
- Notes: used with Bsure3f2 (see below)
Bsure3f2 aag ctcgag atga agct gaac tcgg cttt g
- Date:
- Purpose: mutating an EcoRI site in ureABC by amplifying the gene cluster as two overlapping fragments, mutating out the EcoRI and introducing an XhoI which could be used to ligate the fragments together.
- Restriction sites: XhoI
- Notes: used with Bsure2r1 (see above)
Bsure3r2 tac actagt tttg tgca ccgt tttt ag
- Date:
- Purpose: converting the final ureABC product to a biobrick by adding the 3' SpeI site.
- Restriction sites: SpeI
- Notes: the alert reader will notice that this would not produce a compliant biobrick since it is missing the A basee after the SpeI site. Oops.


