Cfrench:primerlist

Catalog of primers

Primers for iGEM2007 flavours/fragrances project

echf1 aat gaattc gcggccgc t tctag atg agc aaa tac gaa ggt c

• Purpose: forward primer for ech (ferA) coding sequence from Ps. fluorescens NCIMB 9046.
• Restriction sites: EcoRI, XbaI
• Notes: no ribosome binding site included.

echr1 ct actagt a tta tta gcg ttt ata ggc ttg cag c

• Purpose: reverse primer for ech (ferA) coding sequence from Ps. fluorescens NCIMB 9046.
• Restriction sites: SpeI only.
• Notes: replaces TGA stop codon with TAA TAA. Also replaces PstI site in coding sequence with silent mutation.

fcsf1 aat gaattc gcggccgc t tctag atg cgc tcc ctg gaa ccc

• Purpose: forward primer for fcs (ferB) coding sequence from Ps. fluorescens NCIMB 9046.
• Restriction sites: EcoRI, XbaI
• Notes: no ribosome binding site included.

fcsr1 ct actagt a tta tta cgg ttt ggg ccc ggc ac

• Purpose: reverse primer for fcs (ferB) coding sequence from Ps. fluorescens NCIMB 9046.
• Restriction sites: SpeI only.
• Notes: replaces TGA stop codon with TAA TAA.

Ms_COMTf1 aat gaattc gcggccgc t tctag atg ggt tca aca ggt gaa ac

• Purpose: forward primer for caffeate O-methltransferase coding sequence from Medicago sativa (alfalfa).
• Restriction sites: EcoRI, XbaI.
• Notes: eukaryotic gene, no ribosome binding site.

Ms_COMTr1 ct actagt a tta tta aac ctt ctt aag aaa ctc c

• Purpose: reverse primer for caffeate O-methltransferase coding sequence from Medicago sativa (alfalfa).
• Restriction sites: SpeI only (NOT PstI).
• Notes: adds TAA TAA stop codons.

echf2 atc gagctc acacc cagaa caaga gc

• Date: 9 August 2007.
• Purpose: amplify ech from Pseudomonas with rbs and some surrounding DNA.
• Restriction sites: SacI
• Notes: this was made because no product was obtained with echf1 and echr1.

echr2 tt actagt atcgg gaaca cgttc aagc

• Date: 9 August 2007.
• Purpose: amplify ech from Pseudomonas with rbs and some surrounding DNA.
• Restriction sites: SpeI
• Notes: this was made because no product was obtained with echf1 and echr1.

fcsf2 gtg gagctc actga agaac agggc gtg

• Date: 9 August 2007.
• Purpose: amplify fcs from Pseudomonas with rbs and some surrounding DNA.
• Restriction sites: SacI
• Notes: this was made because no product was obtained with fcsf1 and fcsr1.

fcsr2 aa actagt atgcc gtgac agcaa atagg

• Date: 9 August 2007.
• Purpose: amplify fcs from Pseudomonas with rbs and some surrounding DNA.
• Restriction sites: SpeI
• Notes: this was made because no product was obtained with fcsf1 and fcsr1.

sam5f1 at gaattc gcggccgc t tctag atg acc atc acg tca cct g

• Date: 9 August 2007.
• Purpose: amplify sam5 from Saccharothrix espanaensis.
• Restriction sites: EcoRI, NotI, XbaI (not SacI!)
• Notes: coding sequence only, no ribosome binding site.

sam5r1 ct actagt a tta tta ggt gcc ggg gtt gat cag

• Date: 9 August 2007.
• Purpose: amplify sam5 from Saccharothrix espanaensis.
• Restriction sites: SpeI (not PstI!)
• Notes: coding sequence modified to end with TAA TAA.

sam8f1 at gaattc gcggccgc t tctag atg acg cag gtc gtg gaa cg

• Date: 9 August 2007.
• Purpose: amplify sam8 from Saccharothrix espanaensis.
• Restriction sites: EcoRI, NotI, XbaI (not SacI!)
• Notes: coding sequence only, no ribosome binding site.

sam8r1 ct actagt a tta tta tcc gaa atc ctt ccc gtc

• Date: 9 August 2007.
• Purpose: amplify sa85 from Saccharothrix espanaensis.
• Restriction sites: SpeI (not PstI!)
• Notes: coding sequence modified to end with TAA TAA.

Primers for iGEM2007 bioswitches project

revPlacf1 tcta gagctc tgtgtgaaattgttatccg

• Purpose: forward biobrick primer for making a reverse lac promoter.
• Restriction sites: XbaI (probably won't cut as right at end), SacI

revPlacr1 ct actagt a caatacgcaaaccgcctc

• Purpose: reverse biobrick primer for making a reverse lac promoter.
• Restriction sites: SpeI only.

Primers for working with biobricks

pSB1A3f1 tccttagctttcgctaagg

• Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof.
• Restriction sites: none (but amplification products will have full biobrick prefix)

pSB1A3r1 agggtggtgacaccttgc

• Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof.
• Restriction sites: none (but amplification products will have full biobrick suffix)

pSB1A2insf1 cgctaaggatgatttctgg

• Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof.
• Restriction sites: none (but amplification products will have full biobrick prefix)

• Notes: excellent resuts for sequencing.

pSB1A2insr1 gtcagtgagcgaggaagc

• Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof.
• Restriction sites: none (but amplification products will have full biobrick suffix)
• Notes: excellent resuts for sequencing.

bbinsertf1 attc gcggccgc t tctag

• Purpose: sequencing or amplification of any biobrick insert
• Restriction sites: only NotI, but amplification product will have XbaI, and SacI if present.
• Note: gives good results for sequencing, but pSB1A2insf1 is better.

bbinsertr1 tgcag cggccgc t actag

• Purpose: sequencing or amplification of any biobrick insert
• Restriction sites: only NotI, but amplification product will have SpeI.
• Note: usually not very good results for sequencing.

bbvectorf1 ag t actag ta gcggccg ctgc

• Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick suffix and amplifies vector region.
• Restriction sites: SpeI, NotI; amplification product will also have PstI.

bbvectr1 cctt gagctc taga a gcggccgc gaattc

• Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick prefix and amplifies vector region.
• Restriction sites: SacI, XbaI, EcoRI.

Primers for Escherichia coli lac' genes

laczf1 cctttctagaggaggaaacagctatgacc

• Date: 11 Jul 06
• Purpose: amplification of lacZ' from E. coli BS with its native ribosome binding site.
• Restriction sites: XbaI only
• Notes:

laczf2 ggtctagagctcatgttatatcccg

• Date: 18 July 2006
• Purpose:
• Restriction sites: XbaI
• Notes:

laczf3 gggtcgacaggtttcccgactg

• Date: 18 July 2006
• Purpose:
• Restriction sites:
• Notes:

laczr1 aaggctgcagcggccgctactagtatcactccagccagctttc

• Date: 11 July 2006
• Purpose:
• Restriction sites: PstI, NotI, SpeI
• Notes: Designed to produce a truncated version of lacZ with stop codon TGA at position 77, but also produces minor product truncated with stop codon at position 137, reason unclear.

Eclacr2 gttactagtgtgaaattgttatccgc

• Date: 21 August 2006
• Purpose:
• Restriction sites: SpeI
• Notes:

XWlaczZf1 cctttctagatgaccatgattacggattc

• Date: 27 Feb 2007
• Purpose: amplification of lacZ coding sequence (without rbs) from E. coli.
• Restriction sites: XbaI
• Notes:

XWlacZr1 aaggctgcagcggccgctactagtattattactccagccagctttcc

• Date: 27 Feb 2007
• Purpose: amplification of lacZ coding sequence with TAA TAA double stop codon introduced after codon 76.
• Restriction sites: PstI, NotI, SpeI
• Notes:

eclacyf1 ggcgagctctgcccgtatttcgcgtaag

• Date: 1 Sep 2006
• Purpose: testing for presence of intact lacY in E. coli strains.
• Restriction sites: SacI.
• Notes: Also could be used to clone lacY as a biobrick using SacI/SpeI sites in an Edinbrick vector.

eclacyr1 gatactagtcgcgccgcatccgacattg

• Date: 1 Sep 2006
• Purpose: as above.
• Restriction sites: SpeI
• Notes:

Template

primer

• Date
• Purpose:
• Restriction sites:
• Notes:

Back to Main Page