Cfrench:primerlist
From OpenWetWare
Catalog of primers
Primers for iGEM2007 flavours/fragrances project
echf1 aat gaattc gcggccgc t tctag atg agc aaa tac gaa ggt c
- Purpose: forward primer for ech (ferA) coding sequence from Ps. fluorescens NCIMB 9046.
- Restriction sites: EcoRI, XbaI
- Notes: no ribosome binding site included.
echr1 ct actagt a tta tta gcg ttt ata ggc ttg cag c
- Purpose: reverse primer for ech (ferA) coding sequence from Ps. fluorescens NCIMB 9046.
- Restriction sites: SpeI only.
- Notes: replaces TGA stop codon with TAA TAA. Also replaces PstI site in coding sequence with silent mutation.
fcsf1 aat gaattc gcggccgc t tctag atg cgc tcc ctg gaa ccc
- Purpose: forward primer for fcs (ferB) coding sequence from Ps. fluorescens NCIMB 9046.
- Restriction sites: EcoRI, XbaI
- Notes: no ribosome binding site included.
fcsr1 ct actagt a tta tta cgg ttt ggg ccc ggc ac
- Purpose: reverse primer for fcs (ferB) coding sequence from Ps. fluorescens NCIMB 9046.
- Restriction sites: SpeI only.
- Notes: replaces TGA stop codon with TAA TAA.
Ms_COMTf1 aat gaattc gcggccgc t tctag atg ggt tca aca ggt gaa ac
- Purpose: forward primer for caffeate O-methltransferase coding sequence from Medicago sativa (alfalfa).
- Restriction sites: EcoRI, XbaI.
- Notes: eukaryotic gene, no ribosome binding site.
Ms_COMTr1 ct actagt a tta tta aac ctt ctt aag aaa ctc c
- Purpose: reverse primer for caffeate O-methltransferase coding sequence from Medicago sativa (alfalfa).
- Restriction sites: SpeI only (NOT PstI).
- Notes: adds TAA TAA stop codons.
echf2 atc gagctc acacc cagaa caaga gc
- Date: 9 August 2007.
- Purpose: amplify ech from Pseudomonas with rbs and some surrounding DNA.
- Restriction sites: SacI
- Notes: this was made because no product was obtained with echf1 and echr1.
echr2 tt actagt atcgg gaaca cgttc aagc
- Date: 9 August 2007.
- Purpose: amplify ech from Pseudomonas with rbs and some surrounding DNA.
- Restriction sites: SpeI
- Notes: this was made because no product was obtained with echf1 and echr1.
fcsf2 gtg gagctc actga agaac agggc gtg
- Date: 9 August 2007.
- Purpose: amplify fcs from Pseudomonas with rbs and some surrounding DNA.
- Restriction sites: SacI
- Notes: this was made because no product was obtained with fcsf1 and fcsr1.
fcsr2 aa actagt atgcc gtgac agcaa atagg
- Date: 9 August 2007.
- Purpose: amplify fcs from Pseudomonas with rbs and some surrounding DNA.
- Restriction sites: SpeI
- Notes: this was made because no product was obtained with fcsf1 and fcsr1.
sam5f1 at gaattc gcggccgc t tctag atg acc atc acg tca cct g
- Date: 9 August 2007.
- Purpose: amplify sam5 from Saccharothrix espanaensis.
- Restriction sites: EcoRI, NotI, XbaI (not SacI!)
- Notes: coding sequence only, no ribosome binding site.
sam5r1 ct actagt a tta tta ggt gcc ggg gtt gat cag
- Date: 9 August 2007.
- Purpose: amplify sam5 from Saccharothrix espanaensis.
- Restriction sites: SpeI (not PstI!)
- Notes: coding sequence modified to end with TAA TAA.
sam8f1 at gaattc gcggccgc t tctag atg acg cag gtc gtg gaa cg
- Date: 9 August 2007.
- Purpose: amplify sam8 from Saccharothrix espanaensis.
- Restriction sites: EcoRI, NotI, XbaI (not SacI!)
- Notes: coding sequence only, no ribosome binding site.
sam8r1 ct actagt a tta tta tcc gaa atc ctt ccc gtc
- Date: 9 August 2007.
- Purpose: amplify sa85 from Saccharothrix espanaensis.
- Restriction sites: SpeI (not PstI!)
- Notes: coding sequence modified to end with TAA TAA.
Primers for iGEM2007 bioswitches project
revPlacf1 tcta gagctc tgtgtgaaattgttatccg
- Purpose: forward biobrick primer for making a reverse lac promoter.
- Restriction sites: XbaI (probably won't cut as right at end), SacI
revPlacr1 ct actagt a caatacgcaaaccgcctc
- Purpose: reverse biobrick primer for making a reverse lac promoter.
- Restriction sites: SpeI only.
Primers for working with biobricks
pSB1A3f1 tccttagctttcgctaagg
- Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof.
- Restriction sites: none (but amplification products will have full biobrick prefix)
pSB1A3r1 agggtggtgacaccttgc
- Purpose: sequencing or amplification of biobrick inserts in pSB1A3 and derivatives thereof.
- Restriction sites: none (but amplification products will have full biobrick suffix)
pSB1A2insf1 cgctaaggatgatttctgg
- Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof.
- Restriction sites: none (but amplification products will have full biobrick prefix)
- Notes: excellent resuts for sequencing.
pSB1A2insr1 gtcagtgagcgaggaagc
- Purpose: sequencing or amplification of biobrick inserts in pSB1A2 and derivatives thereof.
- Restriction sites: none (but amplification products will have full biobrick suffix)
- Notes: excellent resuts for sequencing.
bbinsertf1 attc gcggccgc t tctag
- Purpose: sequencing or amplification of any biobrick insert
- Restriction sites: only NotI, but amplification product will have XbaI, and SacI if present.
- Note: gives good results for sequencing, but pSB1A2insf1 is better.
bbinsertr1 tgcag cggccgc t actag
- Purpose: sequencing or amplification of any biobrick insert
- Restriction sites: only NotI, but amplification product will have SpeI.
- Note: usually not very good results for sequencing.
bbvectorf1 ag t actag ta gcggccg ctgc
- Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick suffix and amplifies vector region.
- Restriction sites: SpeI, NotI; amplification product will also have PstI.
bbvectr1 cctt gagctc taga a gcggccgc gaattc
- Purpose: amplification of vector + biobrick for PCR-based cloning procedures; binds to biobrick prefix and amplifies vector region.
- Restriction sites: SacI, XbaI, EcoRI.
Primers for 'Bacillobrick' project
Primers for Bacillus subtilis ureABC genes
Primers for Escherichia coli lac genes
laczf1 cctttctagaggaggaaacagctatgacc
- Date: 11 Jul 06
- Purpose: amplification of lacZ' from E. coli BS with its native ribosome binding site.
- Restriction sites: XbaI only
- Notes:
laczf2 ggtctagagctcatgttatatcccg
- Date: 18 July 2006
- Purpose: Construction of Edinbrick1 (BBa_J33207).
- Restriction sites: XbaI, SacI
- Notes: Puts lacZ into pSB1A2 with a SacI site overlapping the XbaI site. This allows other PCR products to be cloned in replacing the lacZ marker gene after digestion with SacI and SpeI, meaning that primers can be much shorter than if a full prefix or suffix was required. Products are fully compliant biobricks.
laczf3 gggtcgacaggtttcccgactg
- Date: 18 July 2006
- Purpose: Construction of a biobrick vector based on pT7-7.
- Restriction sites: SalI
- Notes: This vector was never completed.
laczr1 aaggctgcagcggccgctactagtatcactccagccagctttc
- Date: 11 July 2006
- Purpose: Designed to produce a truncated version of lacZ with stop codon TGA at position 77.
- Restriction sites: PstI, NotI, SpeI
- Notes: Also produces minor product truncated with stop codon at position 137, reason unclear. Still works fine though.
Eclacr2 gttactagtgtgaaattgttatccgc
- Date: 21 August 2006
- Purpose:
- Restriction sites: SpeI
- Notes:
XWlaczZf1 cctttctagatgaccatgattacggattc
- Date: 27 Feb 2007
- Purpose: amplification of lacZ coding sequence (without rbs) from E. coli.
- Restriction sites: XbaI
- Notes:
XWlacZr1 aaggctgcagcggccgctactagtattattactccagccagctttcc
- Date: 27 Feb 2007
- Purpose: amplification of lacZ coding sequence with TAA TAA double stop codon introduced after codon 76.
- Restriction sites: PstI, NotI, SpeI
- Notes:
eclacyf1 ggcgagctctgcccgtatttcgcgtaag
- Date: 1 Sep 2006
- Purpose: testing for presence of intact lacY in E. coli strains.
- Restriction sites: SacI.
- Notes: Also could be used to clone lacY as a biobrick using SacI/SpeI sites in an Edinbrick vector.
eclacyr1 gatactagtcgcgccgcatccgacattg
- Date: 1 Sep 2006
- Purpose: as above.
- Restriction sites: SpeI
- Notes:
Primers for chromogenic reporter genes
Template
primer
- Date
- Purpose:
- Restriction sites:
- Notes:


