Combining Parts according to sequence homology

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 28: Line 28:
|15-20
|15-20
|}
|}
 +
 +
 +
>_ b0015                                            129 nt vs.
 +
>_ b0014                                            95 nt
 +
scoring matrix: , gap penalties: -12/-2
 +
42.0% identity; Global alignment score: -50
 +
 +
              10        20        30        40        50         
 +
548164 CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGT--TTTATCTG
 +
        ::  :                ::::::  :    :  ::::::::::    ::::: :
 +
_      TCACACT---------------GGCTCA--CCTTCGGGTGGGCCTTTCTGCGTTTATATA
 +
                              10          20        30        40 
 +
 +
      60        70        80        90      100      110       
 +
548164 TTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTT
 +
        :    :  : :::    : ::  : :: :: : :      ::        ::: :::
 +
_      CTA---GAGAGAGAA-----TATAA-AAAGCCAGATTATTAATCC--------GGCTTTT
 +
              50            60        70                80     
 +
 +
      120       
 +
548164 CTGCGTTTATA
 +
        :  ::  :
 +
_      TT--ATTATTT

Revision as of 21:11, 18 September 2009

Combinable Terminators


Part number Directionality/Efficiency Sequence
B0015 Bi,98% (F), 30->60% (R)
B1001 Bi,90% (F), 75% (R)
B0014 10-12
pSC101 and its derivatives pSC101[1] 5
ColE1 ColE1[2, 3] 15-20


>_ b0015 129 nt vs. >_ b0014 95 nt scoring matrix: , gap penalties: -12/-2 42.0% identity; Global alignment score: -50

              10        20        30        40        50          

548164 CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGT--TTTATCTG

       ::  :                ::::::  :    :  ::::::::::    ::::: : 

_ TCACACT---------------GGCTCA--CCTTCGGGTGGGCCTTTCTGCGTTTATATA

                             10          20        30        40   
      60        70        80        90       100       110        

548164 TTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTT

       :    :   : :::     : ::  : :: :: : :      ::        ::: :::

_ CTA---GAGAGAGAA-----TATAA-AAAGCCAGATTATTAATCC--------GGCTTTT

              50             60         70                80      
     120         

548164 CTGCGTTTATA

       :   ::  : 

_ TT--ATTATTT

Personal tools