Combining Parts according to sequence homology

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 6: Line 6:
|Part number
|Part number
|Directionality/Efficiency
|Directionality/Efficiency
-
|Sequence
+
|Type
 +
|Lenght
 +
|Combine with
|-
|-
|[http://partsregistry.org/Part:BBa_B0015 B0015]
|[http://partsregistry.org/Part:BBa_B0015 B0015]
|Bi,98% (F), 30->60% (R)
|Bi,98% (F), 30->60% (R)
 +
|1
 +
|Double
|
|
|-
|-
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_B1001 B1001]
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_B1001 B1001]
|Bi,90% (F), 75% (R)
|Bi,90% (F), 75% (R)
-
|
+
|1
 +
|Single
|-
|-
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_B0014 B0014]
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_B0014 B0014]
 +
|Bi,96% (F), 96% (R)
 +
|1
 +
|Double
|
|
-
|10-12
 
|-
|-
-
|[[pSC101]] and its derivatives
+
|[http://partsregistry.org/Part:BBa_B0011 B0011]
-
|pSC101<cite>Cohen-JBacteriol-1977</cite>
+
|Bi, ,95% (F), 86% (R)
-
|5
+
|46bp
 +
|
|-
|-
|[[ColE1]]
|[[ColE1]]
Line 28: Line 36:
|15-20
|15-20
|}
|}
-
 
-
 
-
>_ b0015                                            129 nt vs.
 
-
>_ b0014                                            95 nt
 
-
scoring matrix: , gap penalties: -12/-2
 
-
42.0% identity; Global alignment score: -50
 
-
 
-
              10        20        30        40        50         
 
-
548164 CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGT--TTTATCTG
 
-
        ::  :                ::::::  :    :  ::::::::::    ::::: :
 
-
_      TCACACT---------------GGCTCA--CCTTCGGGTGGGCCTTTCTGCGTTTATATA
 
-
                              10          20        30        40 
 
-
 
-
      60        70        80        90      100      110       
 
-
548164 TTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTT
 
-
        :    :  : :::    : ::  : :: :: : :      ::        ::: :::
 
-
_      CTA---GAGAGAGAA-----TATAA-AAAGCCAGATTATTAATCC--------GGCTTTT
 
-
              50            60        70                80     
 
-
 
-
      120       
 
-
548164 CTGCGTTTATA
 
-
        :  ::  :
 
-
_      TT--ATTATTT
 

Revision as of 20:19, 18 September 2009

Combinable Terminators


Part number Directionality/Efficiency Type Lenght Combine with
B0015 Bi,98% (F), 30->60% (R) 1 Double
B1001 Bi,90% (F), 75% (R) 1 Single
B0014 Bi,96% (F), 96% (R) 1 Double
B0011 Bi, ,95% (F), 86% (R) 46bp
ColE1 ColE1[1, 2] 15-20
Personal tools