Construction Files

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 10: Line 10:
<li>[[BerkiGEMwet2009 | Home]]</li>
<li>[[BerkiGEMwet2009 | Home]]</li>
<li>[[UCBigem09-Protocols | Protocols]]</li>
<li>[[UCBigem09-Protocols | Protocols]]</li>
 +
<li>[[Data| Data]]</li>
<li>[[Notebooks | Notebooks]]</li>
<li>[[Notebooks | Notebooks]]</li>
<li id="current">[[Construction Files | ConstructionFiles ]] </li>
<li id="current">[[Construction Files | ConstructionFiles ]] </li>

Revision as of 19:24, 14 August 2009

University of California Berkeley iGem 2009 Wetlab Team




Contents


Gene Synthesis of B09ig1 {<azo1653 AtD>}

Pool O09ig1 through O09ig26, assemble by PCA
PCR O09ig1/O09ig26 on PCA reaction        (860, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig1   {<azo1653 AtD>}
----
O09ig1     PCA assembly of {<azo1653 AtD>} (B09ig1)
CCATAGAATTCATGAGATCTTGGACCCAGATGTCTTCTGGCACTC
O09ig2     PCA assembly of {<azo1653 AtD>} (B09ig1)
TAGCACCAGCGTTACCGTCGTCGTTCATACGCTGAGTGCCAGAAGACATCTGG
O09ig3     PCA assembly of {?azo1653 AtD>} (B09ig1)
CGACGGTAACGCTGGTGCTACCACCCAGGACTTCGACGGTGCTCTGATCGGTG
O09ig4     PCA assembly of {?azo1653 AtD?} (B09ig1)
CAACACGCCAGTCACCGAAAGCCGGCAGGTCACCACCGATCAGAGCACCGTCG
O09ig5     PCA assembly of {?azo1653 AtD?} (B09ig1)
TTTCGGTGACTGGCGTGTTGGTGCTGCTATCGGTTACGACATCGCTCAGGTTT
O09ig6     PCA assembly of {?azo1653 AtD?} (B09ig1)
TGGTTTCACCCTCTGCCTGACGAGAACCAACAGAAACCTGAGCGATGTCGTAA
O09ig7     PCA assembly of {?azo1653 AtD?} (B09ig1)
TCAGGCAGAGGGTGAAACCAAAACCCGTCGTTTCGCTCTGTACTCTGGTAAAT
O09ig8     PCA assembly of {?azo1653 AtD?} (B09ig1)
CACGCAGAGAGTTACCGTCAGCCAGTTCGAAAGATTTACCAGAGTACAGAGCG
O09ig9     PCA assembly of {?azo1653 AtD?} (B09ig1)
TGACGGTAACTCTCTGCGTGTTTTCGGTGGTGCTGCTTACTCTCTGCACCGTC
O09ig10     PCA assembly of {?azo1653 AtD?} (B09ig1)
CGTCGATCAGAGAAACGTCACGAGCAGATTCCAGACGGTGCAGAGAGTAAGCA
O09ig11     PCA assembly of {?azo1653 AtD?} (B09ig1)
TGACGTTTCTCTGATCGACGGTGTTGAACACCTGACCCGTGGTTACGACGTTG
O09ig12     PCA assembly of {?azo1653 AtD?} (B09ig1)
GGTAAGCCAGTTCACCGAAGAGTTGACGGGTAACAACGTCGTAACCACGGGTC
O09ig13     PCA assembly of {?azo1653 AtD?} (B09ig1)
CTTCGGTGAACTGGCTTACCGTCTGGGTCTGGGTGAAAAATCTCACGTTGAAC
O09ig14     PCA assembly of {?azo1653 AtD?} (B09ig1)
CACGCTGAGCAACACGCATCAGACCAACGAACGGTTCAACGTGAGATTTTTCA
O09ig15     PCA assembly of {?azo1653 AtD?} (B09ig1)
GATGCGTGTTGCTCAGCGTGCTGACGGTTTCCAGGAAGAAGGTGGTTCTGCTG
O09ig16     PCA assembly of {?azo1653 AtD?} (B09ig1)
GCAGAGCGTTACGCTGAGAGTCACCAGCCAGAGCAGCAGAACCACCTTCTTCC
O09ig17     PCA assembly of {?azo1653 AtD?} (B09ig1)
CTCTCAGCGTAACGCTCTGCTGATCTCTACCCTGGGTGCTCGTGGTCAGCACG
O09ig18     PCA assembly of {?azo1653 AtD?} (B09ig1)
TCAGTTCGATGTCCAGACCACCCAGGTTAACAGCGTGCTGACCACGAGCACCC
O09ig19     PCA assembly of {?azo1653 AtD?} (B09ig1)
TGGTCTGGACATCGAACTGAAAGGTTCTGTTACCTGGCGTCACCTGGAAGGTG
O09ig20     PCA assembly of {?azo1653 AtD?} (B09ig1)
CAGACAGACGCAGACCCAGTTCCGGACGAACGTCACCTTCCAGGTGACGCCAG
O09ig21     PCA assembly of {?azo1653 AtD?} (B09ig1)
ACTGGGTCTGCGTCTGTCTGGTGGTGCTCGTTTCACCGTTATGGGCACTGAAC
O09ig22     PCA assembly of {?azo1653 AtD?} (B09ig1)
CGTTCAGGGTCAGCAGCATAGAGTCACGCGGCAGTTCAGTGCCCATAACGGTG
O09ig23     PCA assembly of {?azo1653 AtD?} (B09ig1)
TATGCTGCTGACCCTGAACGCTAACTACGACCTGATGGCTGGTGTTGTTCTGA
O09ig24     PCA assembly of {?azo1653 AtD?} (B09ig1)
CAGAGTCAGAGGTCATAGCGTTAACACCAACGTTCAGAACAACACCAGCCATC
O09ig25     PCA assembly of {?azo1653 AtD?} (B09ig1)
CGCTATGACCTCTGACTCTGGTAACGCTGCTGCTCTGGTTGCTAACCTGCGCT
O09ig26     PCA assembly of {?azo1653 AtD?} (B09ig1)
CGTTAGGATCCGTTCATTTTCCAGCGCAGGTTAGCAACCAGA

Gene Synthesis of B09ig27 {<Nmul_A1566 AtD>}

Pool O09ig27 through O09ig56, assemble by PCA
PCR O09ig27/O09ig56 on PCA reaction        (848, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig27   {?Nmul_A1566 AtD?}
----
O09ig27     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
CCATAGAATTCATGAGATCTGCTTTCTGGACCCGTACCTTCGGTTC
O09ig28     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
GTTCATGTCACCAGAACGGTGACCGAAAGAACCGAAGGTACGGGTCCA
O09ig29     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
ACCGTTCTGGTGACATGAACGCTGCTCGTATCAACCGTAACATCGGTG
O09ig30     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
ACCAGGGTGTCACCACCCATGAAGAAACCACCGATGTTACGGTTGATA
O09ig31     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
ATGGGTGGTGACACCCTGGTTGCTGACCTGCTGCGTCTGGGTATCGCT
O09ig32     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
CGTTGAAAGAAGAGTTAGAGTAACCACCAGCGATACCCAGACGCAGCA
O09ig33     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
CTCTAACTCTTCTTTCAACGTTAACGAACGTTTCTCTACTGGCTCTTC
O09ig34     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
ACCGTAAGCGGTAACGTGGTAGTTGTCAGAAGAGCCAGTAGAGAAACG
O09ig35     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
ACCACGTTACCGCTTACGGTGGCACTCGTTGGCACGCTCTGGGTCTGC
O09ig36     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
TCGTGCCAGGTGTAACCACCACCGAAACGCAGACCCAGAGCGTGCCAA
O09ig37     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
GGTGGTTACACCTGGCACGACTTCGAAACCAACCGTAATATTCTGTTT
O09ig38     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
CACCTTTAGCCTGGTTGTTGAAACCTGGAAACAGAATATTACGGTTGG
O09ig39     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
CAACAACCAGGCTAAAGGTGACTACCGTGGTCGTACTGGCCAGGTTTT
O09ig40     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
GAACGGCAGTTCGTAACCCAGTTCACCGAAAACCTGGCCAGTACGACC
O09ig41     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
TGGGTTACGAACTGCCGTTCAAAAACGTTTCTCTGGAACCGTTCGCTG
O09ig42     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
TTGGTAGCCAGGTTAACGTAAGCAACACCAGCGAACGGTTCCAGAGAA
O09ig43     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
TACGTTAACCTGGCTACCAAAGGTTTCCAGGAACGTGGTGGTATCGCT
O09ig44     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
CTTCGTTGTCACGAGAAGAAGACAGAGCAGCGATACCACCACGTTCCT
O09ig45     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
TTCTTCTCGTGACAACGAAGGTGTTACCTACTCTACCGTTGGTATGAA
O09ig46     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
ACCAGCGGTAGAGAACATAGAAGCAGCGTTCATACCAACGGTAGAGTA
O09ig47     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
CTATGTTCTCTACCGCTGGTGGCACTACCACCCGTCTGCGTGGTTCTC
O09ig48     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
ACAGAGTCGAAAGCGTGACGCCAACCCAGAGAACCACGCAGACGGGTG
O09ig49     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
CGTCACGCTTTCGACTCTGTTCCGACCCGTTCTTCTGTTGCTTTCTCT
O09ig50     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
TGCCAGCGATACCGAAAGCAGAACCACCAGAGAAAGCAACAGAAGAAC
O09ig51     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
TGCTTTCGGTATCGCTGGCACTCCGATCGCTAAAGACGCTATGATCAT
O09ig52     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
ACCAACAGAAGCGTCCAGACCAGCACCGATGATCATAGCGTCTTTAGC
O09ig53     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
GTCTGGACGCTTCTGTTGGTAAAAACGCTATCCTGGGTATCGCTTACA
O09ig54     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
TCAACAACGTTAGAGAAAACCTGGCCAGTGTAAGCGATACCCAGGATA
O09ig55     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
GTTTTCTCTAACGTTGTTGACAACGGTGTTCGTGCTAACCTGGACTGG
O09ig56     PCA assembly of {?Nmul_A1566 AtD?} (B09ig27)
CGTTAGGATCCGAAACGCCAGTCCAGGTTAGCACGAA

Gene Synthesis of B09ig57 {<OprF AtD>}

Pool O09ig57 through O09ig78, assemble by PCA
PCR O09ig57/O09ig78 on PCA reaction        (710, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig57   {?OprF AtD?}
----
O09ig57     PCA assembly of {?OprF AtD?} (B09ig57)
CCATAGAATTCATGAGATCTGACTCTAAAATGACTGGCGCTTACGGTC
O09ig58     PCA assembly of {?OprF AtD?} (B09ig57)
AGAGGTAGAGTCAGAGATACCTTTTTCGATCTGACCGTAAGCGCCAGTCATT
O09ig59     PCA assembly of {?OprF AtD?} (B09ig57)
GTATCTCTGACTCTACCTCTGTTGGTCTGATGCTGGGTGGTAACAACAACAA
O09ig60     PCA assembly of {?OprF AtD?} (B09ig57)
TACCTTTCAGGTCAGAGGTAGCGATGTCAACTTTGTTGTTGTTACCACCCAG
O09ig61     PCA assembly of {?OprF AtD?} (B09ig57)
TACCTCTGACCTGAAAGGTAACTCTGCTTACCTGGGTGGTTACGTTAAACAC
O09ig62     PCA assembly of {?OprF AtD?} (B09ig57)
ATACCAGCGATACCACGGAAAGCACCTTTGTCGTGTTTAACGTAACCACCCA
O09ig63     PCA assembly of {?OprF AtD?} (B09ig57)
TTCCGTGGTATCGCTGGTATCGGTATCCAGTACTCTGACTGGGACTCTCACC
O09ig64     PCA assembly of {?OprF AtD?} (B09ig57)
GTTTTCTTTGTAAGAGTCAGACATGGTGTTACGGTGAGAGTCCCAGTCAGAG
O09ig65     PCA assembly of {?OprF AtD?} (B09ig57)
CTGACTCTTACAAAGAAAACTACTCTGACCGTGGTCTGAACATCTACGCAGA
O09ig66     PCA assembly of {?OprF AtD?} (B09ig57)
GACCTTCGGTCAGTTCTTTGGTGTATTTACCCTCTGCGTAGATGTTCAGACC
O09ig67     PCA assembly of {?OprF AtD?} (B09ig57)
CAAAGAACTGACCGAAGGTCTGTTCCTGGAACCGAAAGTTGGTGTTTCTTAC
O09ig68     PCA assembly of {?OprF AtD?} (B09ig57)
GATTCGTTGATAGATTCCTGTTTGATGTAGTCGTAAGAAACACCAACTTTCG
O09ig69     PCA assembly of {?OprF AtD?} (B09ig57)
CAGGAATCTATCAACGAATCTAAAGACAAAGCTCTGGCTCTGGAAGTTGACG
O09ig70     PCA assembly of {?OprF AtD?} (B09ig57)
AACGTTACCAGACAGGGTGTCGAAGTCTTTACCGTCAACTTCCAGAGCCAGA
O09ig71     PCA assembly of {?OprF AtD?} (B09ig57)
ACACCCTGTCTGGTAACGTTGGTCTGGACCTGCGTAAAGAAATCGTTACCGA
O09ig72     PCA assembly of {?OprF AtD?} (B09ig57)
TAACACCAGCGGTCAGGTTGTGTTTACCTTTTTCGGTAACGATTTCTTTACG
O09ig73     PCA assembly of {?OprF AtD?} (B09ig57)
CAACCTGACCGCTGGTGTTAACTACACCCGTATCCTGTCTGGTGCTGACGAA
O09ig74     PCA assembly of {?OprF AtD?} (B09ig57)
GAGTTACCACCGAAGTTGCCAGTCAGGTTGTCTTCGTCAGCACCAGACAGGA
O09ig75     PCA assembly of {?OprF AtD?} (B09ig57)
GGCAACTTCGGTGGTAACTCTTTCGATATTCTGGTTCCGCAGAAAACCAAAG
O09ig76     PCA assembly of {?OprF AtD?} (B09ig57)
GATGTCGTATTTGATACCAACAGAAACGTTGTCTTTGGTTTTCTGCGGAACC
O09ig77     PCA assembly of {?OprF AtD?} (B09ig57)
TTGGTATCAAATACGACATCGAACTGGAAACTGGCGTTATGCTGGGTGCTAA
O09ig78     PCA assembly of {?OprF AtD?} (B09ig57)
CGTTAGGATCCGTAAGAAACTTTAGCACCCAGCATAACGCC

Gene Synthesis of B09ig79 {<cl02365 AtD>}

Pool O09ig79 through O09ig112, assemble by PCA
PCR O09ig79/O09ig112 on PCA reaction        (854, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig79   {?cl02365 AtD?}
----
O09ig79     PCA assembly of {?cl02365 AtD?} (B09ig79)
CCATAGAATTCATGAGATCTGAAAACTCTAACGCTCGTA
O09ig80     PCA assembly of {?cl02365 AtD?} (B09ig79)
CACTGACCAACGCCAGTCATCCACATACGAGCGTTAGAGTTTTCA
O09ig81     PCA assembly of {?cl02365 AtD?} (B09ig79)
ATGACTGGCGTTGGTCAGTGGGGTAACCTGGACTACGGTTACTCT
O09ig82     PCA assembly of {?cl02365 AtD?} (B09ig79)
CAGCGTAGAAGTCAACGTCCATGTTAGAGTAACCGTAGTCCAGGT
O09ig83     PCA assembly of {?cl02365 AtD?} (B09ig79)
GGACGTTGACTTCTACGCTGGTCTGGTTGGTGCTGAAATCGACGT
O09ig84     PCA assembly of {?cl02365 AtD?} (B09ig79)
CAGACCAGCTTTGGTGTTTTCGGTAACGTCGATTTCAGCACCAAC
O09ig85     PCA assembly of {?cl02365 AtD?} (B09ig79)
AAAACACCAAAGCTGGTCTGTTCTTCGGTGCTGGTTCTACCCACT
O09ig86     PCA assembly of {?cl02365 AtD?} (B09ig79)
ATTTTACCGTATTCGTGAGCTTTGTAGTGGGTAGAACCAGCACCG
O09ig87     PCA assembly of {?cl02365 AtD?} (B09ig79)
GCTCACGAATACGGTAAAATCGACTCTAACGACCTCCATGTTGGT
O09ig88     PCA assembly of {?cl02365 AtD?} (B09ig79)
CTTTGATGTTAGAAACACCGTACAGACCAACATGGAGGTCGTTAG
O09ig89     PCA assembly of {?cl02365 AtD?} (B09ig79)
CGGTGTTTCTAACATCAAAGACGTTGCTGCTGTTAACTACGGTAT
O09ig90     PCA assembly of {?cl02365 AtD?} (B09ig79)
GTCACGGTCCTGGTTGGTGTGGGTGATACCGTAGTTAACAGCAGC
O09ig91     PCA assembly of {?cl02365 AtD?} (B09ig79)
ACACCAACCAGGACCGTGACGCTAAACGTACCCTGTGGGTTGGTC
O09ig92     PCA assembly of {?cl02365 AtD?} (B09ig79)
GAGGTAGAGTTGTAACCAGAGGTCTGACCAACCCACAGGGTACGT
O09ig93     PCA assembly of {?cl02365 AtD?} (B09ig79)
TCTGGTTACAACTCTACCTCTTACGACGCTAAAATCACCCAGTTC
O09ig94     PCA assembly of {?cl02365 AtD?} (B09ig79)
GTTGGGTGTAAGCACCTTCCAGGAAGAACTGGGTGATTTTAGCGT
O09ig95     PCA assembly of {?cl02365 AtD?} (B09ig79)
GGAAGGTGCTTACACCCAACTCAACAACGACAAATACTCTATCGA
O09ig96     PCA assembly of {?cl02365 AtD?} (B09ig79)
GAGCCAGTTGAAACCAGCGTACGGTTCGATAGAGTATTTGTCGTT
O09ig97     PCA assembly of {?cl02365 AtD?} (B09ig79)
ACGCTGGTTTCAACTGGCTCCATGTTTCTACCGACTCTATCAACG
O09ig98     PCA assembly of {?cl02365 AtD?} (B09ig79)
GAGAACTGCATGTTACCAACCTGTTCGTTGATAGAGTCGGTAGAA
O09ig99     PCA assembly of {?cl02365 AtD?} (B09ig79)
GTTGGTAACATGCAGTTCTCTACCAAAACCGACAACCAGGACATC
O09ig100     PCA assembly of {?cl02365 AtD?} (B09ig79)
CACGCAGACCGATAGTGCCAACCTGGATGTCCTGGTTGTCGGTTT
O09ig101     PCA assembly of {?cl02365 AtD?} (B09ig79)
TGGCACTATCGGTCTGCGTGGTGGTTACCCGTTCACCGCTGGTTC
O09ig102     PCA assembly of {?cl02365 AtD?} (B09ig79)
GTCACCTTTCAGAGCCATGTTGATAGAACCAGCGGTGAACGGGTA
O09ig103     PCA assembly of {?cl02365 AtD?} (B09ig79)
ACATGGCTCTGAAAGGTGACGTTTCTGCTTCTCACCTGTTCGGTG
O09ig104     PCA assembly of {?cl02365 AtD?} (B09ig79)
TAGAGTTGAGCTTCCGGACGGTTGTCACCGAACAGGTGAGAAGCA
O09ig105     PCA assembly of {?cl02365 AtD?} (B09ig79)
CGTCCGGAAGCTCAACTCTACCTGTCTAACTCTGGTGAAGCTACC
O09ig106     PCA assembly of {?cl02365 AtD?} (B09ig79)
GGTTGTCCAGTTTACCACCACGCAGGGTAGCTTCACCAGAGTTAG
O09ig107     PCA assembly of {?cl02365 AtD?} (B09ig79)
TGGTGGTAAACTGGACAACCTGTTCGGTGTTGGTCTGGGTGTTGA
O09ig108     PCA assembly of {?cl02365 AtD?} (B09ig79)
GGTGGTAGATTTGTTGAGTTGAGCGTCAACACCCAGACCAACACC
O09ig109     PCA assembly of {?cl02365 AtD?} (B09ig79)
AACTCAACAAATCTACCACCTTCGGTGTTTCTTACCAGGGTCAGT
O09ig110     PCA assembly of {?cl02365 AtD?} (B09ig79)
CCAGAAGAAGAAACGTCAGAGTTGTACTGACCCTGGTAAGAAACA
O09ig111     PCA assembly of {?cl02365 AtD?} (B09ig79)
TCTGACGTTTCTTCTTCTGGTATCAACGCTACCCTGAAAGTTAAC
O09ig112     PCA assembly of {?cl02365 AtD?} (B09ig79)
CGTTAGGATCCGAAGTTAACTTTCAGGGTAGCGT

Gene Synthesis of B09ig113 {<VtaA11 AtD>}

Pool O09ig113 through O09ig120, assemble by PCA
PCR O09ig113/O09ig120 on PCA reaction        (269, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig113   {?VtaA11 AtD?}
----
O09ig113     PCA assembly of {?VtaA11 AtD?} (B09ig113)
CCATAGAATTCATGAGATCTAACAACAAAGCTCTGCGTGCTGGTATCG
O09ig114     PCA assembly of {?VtaA11 AtD?} (B09ig113)
CCTGCGGCAGACCAGCAGCAGCGTTAGAACCAGCGATACCAGCACGCAGAGCT
O09ig115     PCA assembly of {?VtaA11 AtD?} (B09ig113)
TGCTGCTGGTCTGCCGCAGGTTTATATTCCGGGTAAATCTATGGTTGCTGTTT
O09ig116     PCA assembly of {?VtaA11 AtD?} (B09ig113)
CCAGAGCAGACTGACCTTTGAAAGTGCCAGCAGAAACAGCAACCATAGATTTA
O09ig117     PCA assembly of {?VtaA11 AtD?} (B09ig113)
CAAAGGTCAGTCTGCTCTGGCTGTTGGTTACTCTCGTGCTTCTGACAACGGTA
O09ig118     PCA assembly of {?VtaA11 AtD?} (B09ig113)
TGTTAGCGTTACCTTGGAGTTTCAGGATCAGTTTACCGTTGTCAGAAGCACGA
O09ig119     PCA assembly of {?VtaA11 AtD?} (B09ig113)
ACTCCAAGGTAACGCTAACACCTCTGGTGAAATGGGTGGTTCTGTTGGTGTTG
O09ig120     PCA assembly of {?VtaA11 AtD?} (B09ig113)
CGTTAGGATCCCCACTGGTAACCAACACCAACAGAACCACCC

Gene Synthesis of B09ig121 {<Hag AtD>}

Pool O09ig121 through O09ig128, assemble by PCA
PCR O09ig121/O09ig128 on PCA reaction        (269, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig121   {?Hag AtD?}
----
O09ig121     PCA assembly of {?Hag AtD?} (B09ig121)
CCATAGAATTCATGAGATCTAACGAAAACAAAGCTAACGCTGGTATCT
O09ig122     PCA assembly of {?Hag AtD?} (B09ig121)
CCTGCGGCATAGAAGCCATAGCCATAGCAGAAGAGATACCAGCGTTAGCTTTG
O09ig123     PCA assembly of {?Hag AtD?} (B09ig121)
TATGGCTTCTATGCCGCAGGCTTATATTCCGGGTCGTTCTATGGTTACTGGCG
O09ig124     PCA assembly of {?Hag AtD?} (B09ig121)
CAACAGCACCCTGACCGTTGTGGGTAGCGATACCGCCAGTAACCATAGAACGA
O09ig125     PCA assembly of {?Hag AtD?} (B09ig121)
CAACGGTCAGGGTGCTGTTGCTGTTGGTCTGTCTAAACTGTCTGACAACGGTC
O09ig126     PCA assembly of {?Hag AtD?} (B09ig121)
TGTCAGCAGAACCGTTGATTTTGAAAACCCACTGACCGTTGTCAGACAGTTTA
O09ig127     PCA assembly of {?Hag AtD?} (B09ig121)
AATCAACGGTTCTGCTGACACTCAAGGCCATGTAGGTGCTGCTGTTGGTGCTG
O09ig128     PCA assembly of {?Hag AtD?} (B09ig121)
CGTTAGGATCCGAAGTGGAAACCAGCACCAACAGCAGCACCT

Gene Synthesis of B09ig129 {<Pcryo_1225 AtD>}

Pool O09ig129 through O09ig136, assemble by PCA
PCR O09ig129/O09ig136 on PCA reaction        (272, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig129   {?Pcryo_1225 AtD?}
----
O09ig129     PCA assembly of {?Pcryo_1225 AtD?} (B09ig129)
CCATAGAATTCATGAGATCTGTTGAAGACGACGCTAACGCTGGT
O09ig130     PCA assembly of {?Pcryo_1225 AtD?} (B09ig129)
GCGGCAGAGAAGACATAGCCATAGCAGCAGAGATACCAGCGTTAGCGTCGTCTT
O09ig131     PCA assembly of {?Pcryo_1225 AtD?} (B09ig129)
GGCTATGTCTTCTCTGCCGCAGGCTTACATCATCGGTAAACCGATGATCGGTGG
O09ig132     PCA assembly of {?Pcryo_1225 AtD?} (B09ig129)
AACAGCAGATTCACCGTTGTAGGTAGCGATACCACCACCGATCATCGGTTTACC
O09ig133     PCA assembly of {?Pcryo_1225 AtD?} (B09ig129)
ACAACGGTGAATCTGCTGTTGCTATCGGTTTCTCTAAAATGTCTAACGACGGTC
O09ig134     PCA assembly of {?Pcryo_1225 AtD?} (B09ig129)
GTGTCAGCAGTGCCGTTCAGTTTCATAACCCAACGACCGTCGTTAGACATTTTA
O09ig135     PCA assembly of {?Pcryo_1225 AtD?} (B09ig129)
CTGAACGGCACTGCTGACACTCAAGGCAATGTAGGTGCTGCTATCGGTGCTGGT
O09ig136     PCA assembly of {?Pcryo_1225 AtD?} (B09ig129)
CGTTAGGATCCGTCGAAGTGGAAACCAGCACCGATAGCAGCAC

Gene Synthesis of B09ig171 {<gliadin binding scFv>}

Pool O09ig171 through O09ig200, assemble by PCA
PCR O09ig171/O09ig200 on PCA reaction        (842, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig171   {?gliadin binding scFv?}
----
O09ig171     PCA assembly of {?gliadin binding scFv?} (B09ig171)
CCATAGAATTCATGAGATCTGCTCAGGTTCAACTCGTTCA
O09ig172     PCA assembly of {?gliadin binding scFv?} (B09ig171)
ACCCGGCTGAACAACACCACCACCAGACTGAACGAGTTGAACCTGAGC
O09ig173     PCA assembly of {?gliadin binding scFv?} (B09ig171)
GTGGTGTTGTTCAGCCGGGTCGTTCTCTGCGTCTGTCTTGCGCTGCTT
O09ig174     PCA assembly of {?gliadin binding scFv?} (B09ig171)
ATATCGTAGATAGAGAAAGAGAAACCAGAAGCAGCGCAAGACAGACGC
O09ig175     PCA assembly of {?gliadin binding scFv?} (B09ig171)
TCTTTCTCTATCTACGATATGTACTGGGTTCGTCAGGCTCCGGGTAAA
O09ig176     PCA assembly of {?gliadin binding scFv?} (B09ig171)
TAGAGATAACAGCAACCCATTCCAGACCTTTACCCGGAGCCTGACGAA
O09ig177     PCA assembly of {?gliadin binding scFv?} (B09ig171)
ATGGGTTGCTGTTATCTCTACCGACGGTTCTAACAAATTCTACGCTGA
O09ig178     PCA assembly of {?gliadin binding scFv?} (B09ig171)
AGAGATGGTGAAACGACCTTTAACAGAGTCAGCGTAGAATTTGTTAGA
O09ig179     PCA assembly of {?gliadin binding scFv?} (B09ig171)
AAGGTCGTTTCACCATCTCTCGTGACAACTCTAAAAACACCCTGTACC
O09ig180     PCA assembly of {?gliadin binding scFv?} (B09ig171)
TCCTCAACACCCAGAGAGTTCATTTGGAGGTACAGGGTGTTTTTAGAG
O09ig181     PCA assembly of {?gliadin binding scFv?} (B09ig171)
AACTCTCTGGGTGTTGAGGATACCGCTGTTTACTACTGCGCTCGTGAA
O09ig182     PCA assembly of {?gliadin binding scFv?} (B09ig171)
CACCCCATTCTTCGTAAGAACCGTCGATTTCACGAGCGCAGTAGTAAA
O09ig183     PCA assembly of {?gliadin binding scFv?} (B09ig171)
TTCTTACGAAGAATGGGGTGACTACTGGGGTCAGGGCACTCTGGTTTC
O09ig184     PCA assembly of {?gliadin binding scFv?} (B09ig171)
CGGAGAGGTTGGGGAAGCAGAAGAAACAGAAACCAGAGTGCCCTGACC
O09ig185     PCA assembly of {?gliadin binding scFv?} (B09ig171)
CTGCTTCCCCAACCTCTCCGAAACTGGAAGAAGGTGAGTTTTCCGAGG
O09ig186     PCA assembly of {?gliadin binding scFv?} (B09ig171)
GGCTGGGTCAGAACAGACTGAACACGAGCCTCGGAAAACTCACCTTCT
O09ig187     PCA assembly of {?gliadin binding scFv?} (B09ig171)
CAGTCTGTTCTGACCCAGCCGCCGTCTGTTTCTGGTGCTCCGGGTCAG
O09ig188     PCA assembly of {?gliadin binding scFv?} (B09ig171)
AAGAGCCAGTGCAAGAGATGGTAACACGCTGACCCGGAGCACCAGAAA
O09ig189     PCA assembly of {?gliadin binding scFv?} (B09ig171)
CATCTCTTGCACTGGCTCTTCTTCTAACATCGGTGCTGGTTACGACGT
O09ig190     PCA assembly of {?gliadin binding scFv?} (B09ig171)
AGTGCCCGGGAGATGTTGATACCAGTGAACGTCGTAACCAGCACCGAT
O09ig191     PCA assembly of {?gliadin binding scFv?} (B09ig171)
ATCAACATCTCCCGGGCACTGCTCCGAAACTGCTGATCTACGGTAACA
O09ig192     PCA assembly of {?gliadin binding scFv?} (B09ig171)
CGGTCCGGAACACCAGACGGACGGTTTTTGTTACCGTAGATCAGCAGT
O09ig193     PCA assembly of {?gliadin binding scFv?} (B09ig171)
CCGTCTGGTGTTCCGGACCGTTTCTCTGGTTCTAAATCTGGCACTTCT
O09ig194     PCA assembly of {?gliadin binding scFv?} (B09ig171)
CTTGGAGGCCAGTGATAGCCAGAGAAGCAGAAGTGCCAGATTTAGAAC
O09ig195     PCA assembly of {?gliadin binding scFv?} (B09ig171)
GGCTATCACTGGCCTCCAAGCTGAGGATGAAGCTGACTACTACTGCGC
O09ig196     PCA assembly of {?gliadin binding scFv?} (B09ig171)
CCAAACGTTCAGAGAGTCGTCCCAAGCAGCGCAGTAGTAGTCAGCTTC
O09ig197     PCA assembly of {?gliadin binding scFv?} (B09ig171)
ACGACTCTCTGAACGTTTGGGTTTTCGGTGGTGGCACTAAACTGACCG
O09ig198     PCA assembly of {?gliadin binding scFv?} (B09ig171)
GACGGAGCAGCTTTCGGCTGACCCAGAACGGTCAGTTTAGTGCCACCA
O09ig199     PCA assembly of {?gliadin binding scFv?} (B09ig171)
CAGCCGAAAGCTGCTCCGTCTGTTACCCTGTTCCCGCCATCCTCTGCT
O09ig200     PCA assembly of {?gliadin binding scFv?} (B09ig171)
CGTTAGGATCCAGCAGCAGCAGAGGATGGCGGGAACA

Gene Synthesis of B09ig201 {<Cub>}

Pool O09ig201 through O09ig206, assemble by PCA
PCR O09ig201/O09ig206 on PCA reaction        (164, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig201   {?Cub?}
----
O09ig201     PCA assembly of {?Cub?} (B09ig201)
CCATAGAATTCATGAGATCTTCTGGTGGTATCCCGCCGG
O09ig202     PCA assembly of {?Cub?} (B09ig201)
TACCAGCGAAGATGAGGCGTTGCTGGTCCGGCGGGATACCACCAGAA
O09ig203     PCA assembly of {?Cub?} (B09ig201)
ACGCCTCATCTTCGCTGGTAAACAACTCGAAGACGGTCGTACCCTGT
O09ig204     PCA assembly of {?Cub?} (B09ig201)
TAGATTCTTTCTGAATATTGTAGTCAGACAGGGTACGACCGTCTTCG
O09ig205     PCA assembly of {?Cub?} (B09ig201)
CAATATTCAGAAAGAATCTACCCTCCATCTGGTTCTGCGTCTGCGTG
O09ig206     PCA assembly of {?Cub?} (B09ig201)
CGTTAGGATCCACCACCACGCAGACGCAGAACCAGA

Gene Synthesis of B09ig207 {<Nub>}

Pool O09ig207 through O09ig212, assemble by PCA
PCR O09ig207/O09ig212 on PCA reaction        (173, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig207   {?Nub?}
----
O09ig207     PCA assembly of {?Nub?} (B09ig207)
CCATAGAATTCATGAGATCTGGTCTGATGCAAATTTTCGTTAA
O09ig208     PCA assembly of {?Nub?} (B09ig207)
CAGGGTGCCAGTTTTGCCAGTCAGGGTTTTAACGAAAATTTGCATCAG
O09ig209     PCA assembly of {?Nub?} (B09ig207)
CTGGCAAAACTGGCACCCTGGAAGTTGAATCTTCTGACACCATCGACA
O09ig210     PCA assembly of {?Nub?} (B09ig207)
TCTTTGTCCTGGATTTTAGATTTAACGTTGTCGATGGTGTCAGAAGAT
O09ig211     PCA assembly of {?Nub?} (B09ig207)
TCTAAAATCCAGGACAAAGAAGGTATTCCAGGTGGTTGCCGTCCGCGT
O09ig212     PCA assembly of {?Nub?} (B09ig207)
CGTTAGGATCCCATAACACGCGGACGGCAACCACCTG


Gene Synthesis of B09ig137 {<Hia AtD>}

Pool O09ig137 through O09ig144, assemble by PCA
PCR O09ig137/O09ig144 on PCA reaction        (269, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig137   {?Hia AtD?}
----
O09ig137     PCA assembly of {?Hia AtD?} (B09ig137)
CCATAGAATTCATGAGATCTCTGCGTCGTGAAACCTCTGGTGGTGTTG
O09ig138     PCA assembly of {?Hia AtD?} (B09ig137)
CCTGCGGCAGGTTAGCGGTAGCGATAGCAGCAGCAACACCACCAGAGGTTTCA
O09ig139     PCA assembly of {?Hia AtD?} (B09ig137)
TACCGCTAACCTGCCGCAGGCTTACGTTCAGGGTCGTGGTATGACCTCTGTTG
O09ig140     PCA assembly of {?Hia AtD?} (B09ig137)
CGATAGCAGACTGACCCTGGTAAGAAGAAACACCAACAGAGGTCATACCACGA
O09ig141     PCA assembly of {?Hia AtD?} (B09ig137)
CCAGGGTCAGTCTGCTATCGCTGTTGGTGTTTCTGCTGTTTCTGAATCTGGTC
O09ig142     PCA assembly of {?Hia AtD?} (B09ig137)
TGTTAGCAGAACCAGAGAATTTGAAAACCCAGTGACCAGATTCAGAAACAGCA
O09ig143     PCA assembly of {?Hia AtD?} (B09ig137)
ATTCTCTGGTTCTGCTAACACCCGTTCTCACGTTGGTGTTGGTGCTGGTGTTG
O09ig144     PCA assembly of {?Hia AtD?} (B09ig137)
CGTTAGGATCCCCATTGATAGCCAACACCAGCACCAACACCA

Gene Synthesis of B09ig145 {<type IIIs Needle Complex scFV>}

Pool O09ig145 through O09ig170, assemble by PCA
PCR O09ig145/O09ig170 on PCA reaction        (863, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig145   {?type IIIs Needle Complex scFV?} 
----
O09ig145     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
CCATAGAATTCATGAGATCTGCTGAACTGGTTATGACCCAGACCCCGT
O09ig146     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
TAACAGTGCCACCAACAGCAGCGGAAACCGGAGACGGGGTCTGGGTCATAACC
O09ig147     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
TGCTGTTGGTGGCACTGTTACCATCTCTTGCCAATCCTCTCAGTCTGTTTACA
O09ig148     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
GTTTCTGCTGATACCAAGACAGCAGGTTGTTGTTGTAAACAGACTGAGAGGAT
O09ig149     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
GTCTTGGTATCAGCAGAAACCGGGTCAGCCGCCGAAACTGCTGATCTACAACG
O09ig150     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
AACGAGACGGAACACCAGAAGCCAGTTTAGAAGCGTTGTAGATCAGCAGTTTC
O09ig151     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
TTCTGGTGTTCCGTCTCGTTTCAAAGGTTCTGGTTCTGGCACTCAGTTCACCC
O09ig152     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
CTGCGTCGTCGCATTCGAGATCGGAAATAGTCAGGGTGAACTGAGTGCCAGAA
O09ig153     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
TCTCGAATGCGACGACGCAGCAACCTACTACTGCCAGGGCACTTACTACTCTT
O09ig154     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
TAGTGCCACCACCGAAGGTCAGATACCAACCAGAAGAGTAGTAAGTGCCCTGG
O09ig155     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
GACCTTCGGTGGTGGCACTAAACTGGACGTTAAAGGTCAGTCTGGTCAGTCTG
O09ig156     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
CAACACCCTGACCTTCACCAGAACCCGGTTTACCAGACTGACCAGACTGACCT
O09ig157     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
TGGTGAAGGTCAGGGTGTTGGTTCTCAGCAACAACTCGTTGAATCTGGTGGTC
O09ig158     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
GCAGGGTCAGCGGAGTGCCTGGAGTAACCAGACGACCACCAGATTCAACGAGT
O09ig159     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
AGGCACTCCGCTGACCCTGCGTTGCACCGCTTCTGGTTTCTCTCTGTCTAACT
O09ig160     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
TACCCGGAGCCTGACGAACCCAGTTCATGTAGTAGTTAGACAGAGAGAAACCA
O09ig161     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
GGTTCGTCAGGCTCCGGGTAAAGGTCTGGAATGGATCGGTATCATCTACGAAT
O09ig162     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
CTTTAGCCCAAGAAGCGTAGTAGGTGAAACCAGATTCGTAGATGATACCGATC
O09ig163     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
CTACGCTTCTTGGGCTAAAGGTCGTTTCACCATCTCTAAAACCTCTACCACTA
O09ig164     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
CCTCGGTGGTTGGGGAGGTGATTTTCAGGTCCATAGTGGTAGAGGTTTTAGAG
O09ig165     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
CACCTCCCCAACCACCGAGGATACCGCTACCTACTTCTGCGCTCGTTTCGACA
O09ig166     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
CCCACGGGTCGAAAGCACCACCACGGTAACCGATGTCGAAACGAGCGCAGAAG
O09ig167     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
TGGTGCTTTCGACCCGTGGGGTCCGGGCACTCTGGTTACCGTTTCTTCTGGTC
O09ig168     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
CAACGAGTTGAGAAACAGACGGAGCTTTCGGCTGACCAGAAGAAACGGTAACC
O09ig169     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
GTCTGTTTCTCAACTCGTTGGTGCTGAACAAAAGCTCATCTCCGAAGAGGACC
O09ig170     PCA assembly of {?type IIIs Needle Complex scFV?}  (B09ig145)
CGTTAGGATCCAGCACCGTTCAGGTCCTCTTCGGAGATGAGC

Gene Synthesis of B09ig213 {<caspase 3>}

Pool O09ig213 through O09ig238, assemble by PCA
PCR O09ig213/O09ig238 on PCA reaction        (860, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig213   {?caspase 3?}
----
O09ig213     PCA assembly of {?caspase 3?} (B09ig213)
CCATAGAATTCATGAGATCTGAAAACACCGAAAACTCTGTTGACT
O09ig214     PCA assembly of {?caspase 3?} (B09ig213)
TGATTTTCGGTTCCAGGTTTTTGATAGATTTAGAGTCAACAGAGTTTTCGGTG
O09ig215     PCA assembly of {?caspase 3?} (B09ig213)
AAACCTGGAACCGAAAATCATTCATGGTTCTGAATCTATGGACTCTGGTATCT
O09ig216     PCA assembly of {?caspase 3?} (B09ig213)
CCGGGTAGTCCATTTTGTAAGAGTTGTCCAGAGAGATACCAGAGTCCATAGAT
O09ig217     PCA assembly of {?caspase 3?} (B09ig213)
TTACAAAATGGACTACCCGGAAATGGGTCTGTGCATCATCATCAACAACAAAA
O09ig218     PCA assembly of {?caspase 3?} (B09ig213)
AACGAGAGGTCATGCCAGTGGACTTATGAAAGTTTTTGTTGTTGATGATGATG
O09ig219     PCA assembly of {?caspase 3?} (B09ig213)
CACTGGCATGACCTCTCGTTCTGGCACTGACGTTGACGCTGCTAACCTGCGTG
O09ig220     PCA assembly of {?caspase 3?} (B09ig213)
TACGAACTTCGTATTTCAGGTTACGGAAGGTTTCACGCAGGTTAGCAGCGTCA
O09ig221     PCA assembly of {?caspase 3?} (B09ig213)
CCTGAAATACGAAGTTCGTAACAAAAACGACCTGACCCGTGAAGAAATCGTTG
O09ig222     PCA assembly of {?caspase 3?} (B09ig213)
AGTGATCCTCTTTAGAAACGTCACGCATCAGTTCAACGATTTCTTCACGGGTC
O09ig223     PCA assembly of {?caspase 3?} (B09ig213)
CGTTTCTAAAGAGGATCACTCTAAACGTTCTTCTTTCGTTTGCGTTCTGCTGT
O09ig224     PCA assembly of {?caspase 3?} (B09ig213)
TAGTGCCGAAGATGATACCTTCTTCACCGTGAGACAGCAGAACGCAAACGAAA
O09ig225     PCA assembly of {?caspase 3?} (B09ig213)
AGGTATCATCTTCGGCACTAACGGTCCGGTTGACCTGAAAAAAATCACCAACT
O09ig226     PCA assembly of {?caspase 3?} (B09ig213)
CAGTCAGAGAACGGCAGCGATCGCCGCGAAAGAAGTTGGTGATTTTTTTCAGG
O09ig227     PCA assembly of {?caspase 3?} (B09ig213)
TCGCTGCCGTTCTCTGACTGGCAAACCAAAGCTCTTTATTATTCAGGCTTGTC
O09ig228     PCA assembly of {?caspase 3?} (B09ig213)
CGGTTTCGATACCGCAGTCCAGTTCAGTGCCGCGACAAGCCTGAATAATAAAG
O09ig229     PCA assembly of {?caspase 3?} (B09ig213)
GGACTGCGGTATCGAAACCGACTCTGGTGTTGACGACGACATGGCTTGCCACA
O09ig230     PCA assembly of {?caspase 3?} (B09ig213)
AAGCGTACAGGAAGTCAGCTTCAACCGGGATTTTGTGGCAAGCCATGTCGTCG
O09ig231     PCA assembly of {?caspase 3?} (B09ig213)
AGCTGACTTCCTGTACGCTTACTCTACCGCTCCGGGTTACTACTCTTGGCGTA
O09ig232     PCA assembly of {?caspase 3?} (B09ig213)
GGGATTGAATAAACCAAGAACCGTCTTTAGAGTTACGCCAAGAGTAGTAACCC
O09ig233     PCA assembly of {?caspase 3?} (B09ig213)
TTCTTGGTTTATTCAATCCCTCTGCGCTATGCTGAAACAGTACGCTGACAAAC
O09ig234     PCA assembly of {?caspase 3?} (B09ig213)
GGTTAACACGGGTCAGAATATGCATAAACTCCAGTTTGTCAGCGTACTGTTTC
O09ig235     PCA assembly of {?caspase 3?} (B09ig213)
TATTCTGACCCGTGTTAACCGTAAAGTTGCTACCGAGTTTGAATCTTTCTCTT
O09ig236     PCA assembly of {?caspase 3?} (B09ig213)
GGATCTGTTTTTTAGCGTGGAAGGTAGCGTCGAAAGAGAAAGATTCAAACTCG
O09ig237     PCA assembly of {?caspase 3?} (B09ig213)
CCACGCTAAAAAACAGATCCCGTGCATCGTTTCTATGCTGACCAAAGAACTGT
O09ig238     PCA assembly of {?caspase 3?} (B09ig213)
CGTTAGGATCCGTGGTAGAAGTACAGTTCTTTGGTCAGCATA

Gene Synthesis of B09ig239 {<mgfp-5>}

Pool O09ig239 through O09ig248, assemble by PCA
PCR O09ig239/O09ig248 on PCA reaction        (260, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig239   {?mgfp-5?}
----
O09ig239     PCA assembly of {?mgfp-5?} (B09ig239)
CCATAGAATTCATGAGATCTTCTTCCGAGGAATACA
O09ig240     PCA assembly of {?mgfp-5?} (B09ig239)
GGTGTTACCCGGGTAGTAACCACCTTTGTATTCCTCGGAAGAAGAT
O09ig241     PCA assembly of {?mgfp-5?} (B09ig239)
GTTACTACCCGGGTAACACCTACCACTACCACTCTGGTGGTTCTTA
O09ig242     PCA assembly of {?mgfp-5?} (B09ig239)
AACCACCGTGGTAACCAGAACCGTGGTAAGAACCACCAGAGTGGTA
O09ig243     PCA assembly of {?mgfp-5?} (B09ig239)
TTCTGGTTACCACGGTGGTTACAAAGGTAAATACTACGGTAAAGCT
O09ig244     PCA assembly of {?mgfp-5?} (B09ig239)
TTTTTGTATTTGTAGTAGTATTTTTTAGCTTTACCGTAGTATTTAC
O09ig245     PCA assembly of {?mgfp-5?} (B09ig239)
TACTACTACAAATACAAAAACTCTGGTAAATACAAATACCTGAAAA
O09ig246     PCA assembly of {?mgfp-5?} (B09ig239)
ACCTTTACGGTGGTATTTACGAGCTTTTTTCAGGTATTTGTATTTA
O09ig247     PCA assembly of {?mgfp-5?} (B09ig239)
GTAAATACCACCGTAAAGGTTACAAAAAATACTACGGTGGTGGTTC
O09ig248     PCA assembly of {?mgfp-5?} (B09ig239)
CGTTAGGATCCAGAAGAACCACCACCGTAGTATTT

Gene Synthesis of B09ig249 {<Tev N>}

Pool O09ig249 through O09ig260, assemble by PCA
PCR O09ig249/O09ig260 on PCA reaction        (386, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig249   {?Tev N?}
----
O09ig249     PCA assembly of {?Tev N?} (B09ig249)
CCATAGAATTCATGAGATCTGGTGAATCTCTGTTCAAAGGTCCG
O09ig250     PCA assembly of {?Tev N?} (B09ig249)
CAGATGGTAGAAGAGATCGGGTTGTAGTCACGCGGACCTTTGAACAGAGATT
O09ig251     PCA assembly of {?Tev N?} (B09ig249)
CCGATCTCTTCTACCATCTGCCACCTGACCAACGAATCTGACGGTCACACCA
O09ig252     PCA assembly of {?Tev N?} (B09ig249)
GAACGGACCGAAACCGATACCGTACAGAGAGGTGGTGTGACCGTCAGATTCG
O09ig253     PCA assembly of {?Tev N?} (B09ig249)
GTATCGGTTTCGGTCCGTTCATCATCACCAACAAACACCTGTTCCGTCGTAA
O09ig254     PCA assembly of {?Tev N?} (B09ig249)
CGTGGAGGGATTGAACCAGCAGAGTGCCGTTGTTACGACGGAACAGGTGTTT
O09ig255     PCA assembly of {?Tev N?} (B09ig249)
GCTGGTTCAATCCCTCCACGGTGTTTTCAAAGTTAAAAACACCACCACCCTC
O09ig256     PCA assembly of {?Tev N?} (B09ig249)
ATCATGTCACGACCGTCGATGAGATGTTGTTGGAGGGTGGTGGTGTTTTTAA
O09ig257     PCA assembly of {?Tev N?} (B09ig249)
ATCGACGGTCGTGACATGATTATTATTCGTATGCCAAAGGATTTTCCGCCGT
O09ig258     PCA assembly of {?Tev N?} (B09ig249)
CTGCGGTTCACGGAATTTGAGCTTTTGCGGGAACGGCGGAAAATCCTTTGGC
O09ig259     PCA assembly of {?Tev N?} (B09ig249)
TCAAATTCCGTGAACCGCAGCGTGAAGAACGTATCTGCCTCGTAACTACCAA
O09ig260     PCA assembly of {?Tev N?} (B09ig249)
CGTTAGGATCCGGTCTGGAAGTTGGTAGTTACGAGGCAGAT

Gene Synthesis of B09ig261 {<Tev C>}

Pool O09ig261 through O09ig276, assemble by PCA
PCR O09ig261/O09ig276 on PCA reaction        (403, EcoRI/BamHI
Sub in pBca9523-Bca1144#5                (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig261   {?Tev C?}
----
O09ig261     PCA assembly of {?Tev C?} (B09ig261)
CCATAGAATTCATGAGATCTAAATCTATGTCCTCTATG
O09ig262     PCA assembly of {?Tev C?} (B09ig261)
GGAAGGTGCAAGAGGTGTCAGAAACCATAGAGGACATAGATTTAG
O09ig263     PCA assembly of {?Tev C?} (B09ig261)
TGACACCTCTTGCACCTTCCCATCCTCTGACGGTATCTTCTGGAA
O09ig264     PCA assembly of {?Tev C?} (B09ig261)
ACCGTCTTTGGTCTGAATCCAGTGTTTCCAGAAGATACCGTCAGA
O09ig265     PCA assembly of {?Tev C?} (B09ig261)
GGATTCAGACCAAAGACGGTCAGTGCGGTTCTCCGCTGGTTTCTA
O09ig266     PCA assembly of {?Tev C?} (B09ig261)
ATACCAACGATGAAACCGTCACGGGTAGAAACCAGCGGAGAACCG
O09ig267     PCA assembly of {?Tev C?} (B09ig261)
GACGGTTTCATCGTTGGTATCCACTCTGCTTCTAACTTCACCAAC
O09ig268     PCA assembly of {?Tev C?} (B09ig261)
GAACAGAGGTGAAGTAGTTGTTGGTGTTGGTGAAGTTAGAAGCAG
O09ig269     PCA assembly of {?Tev C?} (B09ig261)
CAACTACTTCACCTCTGTTCCAAAGAATTTTATGGAACTGCTGAC
O09ig270     PCA assembly of {?Tev C?} (B09ig261)
AACCCATTGTTGTGCTTCCTGGTTGGTCAGCAGTTCCATAAAATT
O09ig271     PCA assembly of {?Tev C?} (B09ig261)
AGGAAGCACAACAATGGGTTTCTGGTTGGCGTCTGAACGCTGACT
O09ig272     PCA assembly of {?Tev C?} (B09ig261)
ACTTTGTGACCACCCCACAGAACAGAGTCAGCGTTCAGACGCCAA
O09ig273     PCA assembly of {?Tev C?} (B09ig261)
CTGTGGGGTGGTCACAAAGTTTTCATGTCTAAACCGGAAGAACCG
O09ig274     PCA assembly of {?Tev C?} (B09ig261)
GGGTAGCTTCTTTAACCGGCTGGAACGGTTCTTCCGGTTTAGACA
O09ig275     PCA assembly of {?Tev C?} (B09ig261)
GCCGGTTAAAGAAGCTACCCAACTCATGTCTGAACTGGTTTACTC
O09ig276     PCA assembly of {?Tev C?} (B09ig261)
CGTTAGGATCCCTGAGAGTAAACCAGTTCAGACAT

PCR Construction of {<espP(beta)>}

PCR ca998/O09ig280 on M10044		  	(1362, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           	(EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09espP   		{<espP(beta)>}
----
ca998	Forward Oligo 
CCATAGAATTCATGAGATCTTGGACCCAGATGTCTTCTGGCACTC
O09ig280	Reverse Oligo for the removal of the stop codon from {<espP(beta)>}
CGTTAGGATCCgaacgagtaacggaaattagcg

PCR Construction of {<upaG_short>}

PCR ca998/O09ig277 on M10026		  		(279, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           	(EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09upaG   		{<espP(beta)>}
----
ca998	Forward Oligo 
CCATAGAATTCATGAGATCTTGGACCCAGATGTCTTCTGGCACTC
O09ig277	Reverse Oligo for the removal of stop codon from {<upaG_short>}
CGTTAGGATCCccactgaataccggcaccgagtgcg

PCR Construction of {<CPG_L2>}

PCR ca998/O09ig278 on M10086		  		(873, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           	(EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09cpgl2   		{<CPG_L2>}
----
ca998	Forward Oligo 
CCATAGAATTCATGAGATCTTGGACCCAGATGTCTTCTGGCACTC
O09ig278	Reverse Oligo for the removal of stop codon from {<CPG_L2>}
CGTTAGGATCCcgcgctataatctaccggcccttcc

PCR Construction of {<CPG_L6>}

PCR ca998/O09ig279 on M10011		  		(873, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           	(EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09cpgl6  				{<CPG_L6>}
----
ca998	Forward Oligo 
CCATAGAATTCATGAGATCTTGGACCCAGATGTCTTCTGGCACTC
O09cpgl6	Reverse Oligo for the removal of stop codon from {<CPG_L6>}
CGTTAGGATCCctgccagtcccagttactccagcg	

PCR Construction of {<TshA>}

 
PCR ca998/O09ig283 on M10088	(1575, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5          	(EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-O09ig283   	{<TshA>}
-------------------------------------
Ca998  	forward oligo 
gtatcacgaggcagaatttcag
O09ig283 	reverse oligo with stop codons removed for {<TshA>}
gacggGGATCCgaatgaataacgaatattag 

PCR Construction of {<eCPX>}

 
PCR ca998/O09ig282 on M10014 	(477, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           	(EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-O09ig282   	{<eCPX>}
-------------------------------------
Ca998  	forward oligo 
gtatcacgaggcagaatttcag
O09ig282 	reverse oligo with stop codons removed for {<eCPX>}
ccggtGGATCCAGAGCTTGCAGTACGGCTTT

PCR Construction of {<ehaB>}

 
PCR ca998/O09ig281 on M10052	(1229, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           	(EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-O09ig281   	{<ehaB>}
-------------------------------------
Ca998  	forward oligo
gtatcacgaggcagaatttcag
O09ig281 	reverse oligo with stop codons removed for {<ehaB>}
cggtaGGATCCccaggtatatttaacaccca


SOEing construction of B09ig302 {<VirG AtD>}

PCR O09ig302/O09ig301 on S. Flexneri (490bp, gp = frag1)
PCR O09ig300/O09ig303 on S. Flexneri       (986bp, gp = frag2)
----
PCR O09ig302/O09ig303 on mixed frags    (1457bp, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig302         {?VirG AtD?}
----
O09ig302    Forward PCR of {?VirG AtD?} (B09ig302)
AAGTGGAATTCATGAGATCTTCGTCAAATGTCGGTCAGAC
O09ig301    Reverse internal oligo for {?VirG AtD?} (B09ig302)
CTGCCAGCCTCAGGGCGCC
O09ig300    Forward internal oligo for {?VirG AtD?} (B09ig302)
GGCGCCCTGAGGCTGGCAG
O09ig303    Reverse PCR of {?VirG AtD?} (B09ig302)
GTTAGGGATCCGAAGGTATATTTCACACCC

SOEing construction of B09ig306 {<yuaQ AtD>}

PCR O09ig306/O09ig305 on MG1655(ask chris about EcoRV before start)  (464bp, gp = frag1)
PCR O09ig304/O09ig307 on MG1655(ask chris about EcoRV before start)  (452bp, gp = frag2)
----
PCR O09ig306/O09ig307 on mixed frags    (898bp, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig306         {?yuaQ AtD?} 
----
O09ig306    Forward PCR of {?yuaQ AtD?}  (B09ig306)
AAGTGGAATTCATGAGATCTGGAGAACCGAAAGCAACCAG
O09ig305    Reverse internal oligo for {?yuaQ AtD?}  (B09ig306)
GCTGCTGAACTCCCCGATTTTC
O09ig304    Forward internal oligo for {?yuaQ AtD?}  (B09ig306)
GAAAATCGGGGAGTTCAGCAGC
O09ig307    Reverse PCR of {?yuaQ AtD?}  (B09ig306)
GTTAGGGATCCGAATGTATACTTCACACCCAG

SOEing construction of B09ig310 {<AIDA-1 AtD>}

PCR O09ig310/O09ig309 on EHEC (1184bp, gp = frag1)
PCR O09ig308/O09ig311 on EHEC (287bp, gp = frag2)
----
PCR O09ig310/O09ig311 on mixed frags    (1450bp, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig310         {?AIDA-1 AtD?}
----
O09ig310    Forward PCR of {?AIDA-1 AtD?} (B09ig310)
AAGTGGAATTCATGAGATCTGCTGGCAATGTGTTAGTGGTG
O09ig309    Reverse internal oligo for {?AIDA-1 AtD?} (B09ig310)
ATGGTGGCTCTTGAGCCAGGTTTT
O09ig308    Forward internal oligo for {?AIDA-1 AtD?} (B09ig310)
AAAACCTGGCTCAAGAGCCACCAT
O09ig311    Reverse PCR of {?AIDA-1 AtD?} (B09ig310)
GTTAGGGATCCGAATTGCCACTTAATGCCAAC

SOEing construction of B09ig314 {<cel3A!}

PCR O09ig314/O09ig313 on TEMPLATE       (2413bp, gp = frag1)
PCR O09ig312/O09ig315 on TEMPLATE       (171bp, gp = frag2)
----
PCR O09ig314/O09ig315 on mixed frags    (2566bp, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig314         {?cel3A!}
----
O09ig314    Forward PCR of {?cel3A!} (B09ig314)
AAGTGGAATTCATGAGATCTGGTTGTGATTCCCGCGCTCC
O09ig313    Reverse internal oligo for {?cel3A!} (B09ig314)
GCGCCGGAGTTCGGGTAG
O09ig312    Forward internal oligo for {?cel3A!} (B09ig314)
CTACCCGAACTCCGGCGC
O09ig315    Reverse PCR of {?cel3A!} (B09ig314)
GTTAGGGATCCGGGGCAGGCGACGTCTTTTC

SOEing construction of B09ig318 {<cel5B!}

PCR O09ig318/O09ig317 on TEMPLATE       (1226bp, gp = frag1)
PCR O09ig316/O09ig319 on TEMPLATE       (418bp, gp = frag2)
----
PCR O09ig318/O09ig319 on mixed frags    (1625bp, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig318         {?cel5B!}
----
O09ig318    Forward PCR of {?cel5B!} (B09ig318)
AAGTGGAATTCATGAGATCTGATGTCGCGCCGCTGTCCGTAC
O09ig317    Reverse internal oligo for {?cel5B!} (B09ig318)
CAGGCTGGACGAGCTGGAG
O09ig316    Forward internal oligo for {?cel5B!} (B09ig318)
CTCCAGCTCGTCCAGCCTG
O09ig319    Reverse PCR of {?cel5B!} (B09ig318)
GTTAGGGATCCATTGTTACAAACATTACCGC

SOEing construction of B09ig322 {<cel9A!}

PCR O09ig322/O09ig321 on TEMPLATE       (1055bp, gp = frag1)
PCR O09ig320/O09ig323 on TEMPLATE       (1784bp, gp = frag2)
----
PCR O09ig322/O09ig323 on mixed frags    (2821bp, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig322         {?cel9A!}
----
O09ig322    Forward PCR of {?cel9A!} (B09ig322)
AAGTGGAATTCATGAGATCTGAGGTGGGTAACCCCCGTGTC
O09ig321    Reverse internal oligo for {?cel9A!} (B09ig322)
CCAATAGAACTCATCGGC
O09ig320    Forward internal oligo for {?cel9A!} (B09ig322)
GCCGATGAGTTCTATTGG
O09ig323    Reverse PCR of {?cel9A!} (B09ig322)
GTTAGGGATCCCTGACATACACTTCCGGTTAC

Basic PCR construction of B09ig324 {<SOD>}

PCR O09ig324/O09ig325 on MG1655 (ask chris abuot EcoRV before start) (493, EcoRI/BamHI
Sub in pBca9523-Bca1144#5           (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig324         {?SOD?}
----
O09ig324    Forward PCR of {?SOD?} (B09ig324)
CCATAGAATTCATGAGATCTGCCAGTGAAAAAGTCGAGATG
O09ig325    Reverse PCR of {?SOD?} (B09ig324)
CGTTAGGATCCCTTAATTACACCACAGGCATAG

Basic PCR construction of B09ig326 {<Tir-M>}

PCR O09ig326/O09ig327 on E2348/69(O127:H6)EPEC (352, EcoRI/BamHI)
Sub in pBca9523-Bca1144#5           (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig326         {?Tir-M?}
----
O09ig326    Forward PCR of {?Tir-M?} (B09ig326)
CCATAGAATTCATGAGATCTCAGGCGTTGGCTTTGACACC
O09ig327    Reverse PCR of {?Tir-M?} (B09ig326)
CGTTAGGATCCTGAAAGCTGTAATTCCTCCTG

Basic PCR construction of B09ig328 {<cel6A!}

PCR O09ig328/O09ig329 on TEMPLATE       (2041, EcoRI/BamHI
Sub in pBca9523-Bca1144#5           (EcoRI/BamHI, 2472+1224, L)
Product is pBca9523-B09ig328         {?cel6A!}
----
O09ig328    Forward PCR of {?cel6A!} (B09ig328)
CCATAGAATTCATGAGATCTGCATGTACCTACAAAATTAC
O09ig329    Reverse PCR of {?cel6A!} (B09ig328)
CGTTAGGATCCTTGCAGTGGTGGATAAGCG
Personal tools