Designing primers
From OpenWetWare
This needs more work, but wanted to get it started.
General Rules
- Avoid runs over 3 nucleotide (AAAA)
- 18-30bp in length. Molecular Cloning says that 5' tails do not significantly affect annealing.
- Primer pairs should differ in length by less than 3bp.
- 3’ end should be G or C (stronger bond)
- Primer melting temp (Tm) should be 50-60C w/ low FIR difference (<5C, 2C better)
- Molecular Cloning advises GC content between 40% and 60%
- Avoid palindromes and inverted repeat sequences.
- Avoid complementarity between members of a primer pair.
- Check for dimer binding and hairpins in Vector NTI.
- Want to avoid structures with ΔG < -5kcal/mol
BioBrick Primers
To BioBrick a part, the following tails should be added to your primers:
- PREFIX Primer cctttctagag 11 bp
- SUFFIX Primer tactagtagcggccgctgcagcctt 25 bp
The prefix primer adds an Xba site, and the suffix adds the entire BB suffix (Spe-Not-Pst)
Check the annealing temperature both without the tail (the first cycle or so) and with the tail (the later cycles).
Useful Primer Design Tools
- Austin's clipboard tool - online tool for generating the complement, reverse complement and restriction enzyme site analysis of a DNA sequence. It also translates the sequence and gives the amino acids properties.
- Oligo Analyzer] - A relatively complete suite of online tools for primer analysis.
- Invitrogen
- List of Primer Design Software
- Primer3
- PrimerX - This is a useful online tool for designing primers for site directed mutagenesis.
- VectorNTI