Designing primers

From OpenWetWare
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

This needs more work, but wanted to get it started.

General Rules

  • Avoid runs over 3 nucleotide (AAAA)
  • 18-30bp in length. Molecular Cloning says that 5' tails do not significantly affect annealing.
  • Primer pairs should differ in length by less than 3bp.
  • 3’ end should be G or C (stronger bond)
  • Primer melting temp (Tm) should be 50-60C w/ low FIR difference (<5C, 2C better)
  • Molecular Cloning advises GC content between 40% and 60%
  • Avoid palindromes and inverted repeat sequences.
  • Avoid complementarity between members of a primer pair.
  • Check for dimer binding and hairpins in Vector NTI.
    • Want to avoid structures with ΔG < -5kcal/mol

BioBrick Primers

To BioBrick a part, the following tails should be added to your primers:

  • PREFIX Primer        cctttctagag        11 bp
  • SUFFIX Primer        tactagtagcggccgctgcagcctt        25 bp


The prefix primer adds an Xba site, and the suffix adds the entire BB suffix (Spe-Not-Pst)
Check the annealing temperature both without the tail (the first cycle or so) and with the tail (the later cycles).

Useful Primer Design Tools