Eccles:genotyping oligos: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
mNo edit summary
 
Line 54: Line 54:
**Current [stock]:  
**Current [stock]:  
*Annealing Temperature: 58 °C, 1 minute extension
*Annealing Temperature: 58 °C, 1 minute extension
*8F and 9R bind to exon 8 and 9 of the wildtype Mest gene and give a PCR product of 314 bp (wildtype). The mutant band is larger.
*8F and 9R bind to exon 8 and 9 of the wildt ype Mest gene and give a PCR product of 314 bp (wildtype). The mutant band is larger.
*Programme, on Red machine - Jody - Mest
*Programme, on Red machine - Jody - Mest
}}
}}
Line 60: Line 60:
===Pax2-1Neu===
===Pax2-1Neu===
{{hide|1=
{{hide|1=
*Forward Primer: ggg cac ggg ggt gtg aac cag
*Forward Primer: gggcacgggggtgtgaaccag
**DGG ID: 2292
**DGG ID: 2292
**DGG name: P2PB1F
**DGG name: P2PB1F
**Current [stock]:  
**Current [stock]:  


*Reverse Primer: ctg ccc agg att ttg ctg aca cag cc
*Reverse Primer: ctgcccaggattttgctgacacagcc
**DGG ID: 2293  
**DGG ID: 2293  
**DGG name: PAX2EXTR
**DGG name: PAX2EXTR
**Current [stock]:  
**Current [stock]:
*Amplicons: 167 (wt), 168 (mutant)
}}
}}

Latest revision as of 15:30, 11 October 2007

Eccles Lab > DGG Oligos > genotyping_oligos >


MOUSE

KRD PRIMERS

  • Organism: Mus Musculus
  • Forward Primer: CTGCCGGAAATCGTCGTGGTATTCACTCCA (30 bp)
    • DGG ID:
    • DGG name: CATF
    • Current [stock]:
  • Reverse Primer: CCAGACCGTTCAGCTGGATATTACGGCCTT (30 bp)
    • DGG ID:
    • DGG name: CATR
    • Current [stock]:
  • Annealing Temperature: 72 °C
  • approx 250 bp
  • Amplifies a portion of the CAT transgene

GFP PRIMERS

  • Organism: Mus Musculus
  • Forward Primer: AGC GCG ATC ACA TGG TCC TG (20 bp)
    • DGG ID:
    • DGG name: GFPF
    • Current [stock]:
  • Reverse Primer: ACG ATC CTG AGA CTT CCA CAC T (22 bp)
    • DGG ID:
    • DGG name: GFPR
    • Current [stock]:
  • Annealing Temperature: 54°C
  • 321 bp
  • Forward primer in the eGFP cDNA and the reverse is in the globin sequence
  • Programme - Jody - GFP on red machine

MEST PRIMERS

  • Organism: Mus Musculus
  • Forward Primer: AAGACGGAGGTGTGCTTTCC (20 bp)
    • DGG ID:
    • DGG name: Mest8F
    • Current [stock]:
  • Common Primer: TGTCGATGACCAGGTTGCC (19 bp)
    • DGG ID:
    • DGG name: MEST9R
    • Current [stock]:
  • Reverse Primer: GCATCGCCTTCTATCGCCTT (20 bp)
    • DGG ID:
    • DGG name: MEST10FJ
    • Current [stock]:
  • Annealing Temperature: 58 °C, 1 minute extension
  • 8F and 9R bind to exon 8 and 9 of the wildt ype Mest gene and give a PCR product of 314 bp (wildtype). The mutant band is larger.
  • Programme, on Red machine - Jody - Mest

Pax2-1Neu

  • Forward Primer: gggcacgggggtgtgaaccag
    • DGG ID: 2292
    • DGG name: P2PB1F
    • Current [stock]:
  • Reverse Primer: ctgcccaggattttgctgacacagcc
    • DGG ID: 2293
    • DGG name: PAX2EXTR
    • Current [stock]:
  • Amplicons: 167 (wt), 168 (mutant)