Hartings AU Photosynthesis Lab:Materials/Myoglobin/WT Sequence text

From OpenWetWare

< Hartings AU Photosynthesis Lab:Materials | Myoglobin(Difference between revisions)
Jump to: navigation, search

Matt Hartings (Talk | contribs)
(New page: {{Template:Hartings AU Photosynthesis Lab}} ATGGTTCTGTCTGAAGGTGAATGGCAGCTGGTTCTGCATGTTTGGGCTAAAGTTGAAGCTGACGTCGCTGGTCATGGTCAGGACATCTTGATTCGACTGTTCAAATCTCATCCGGAAACTCTGGAAAAATTCGATCGTTTCAA...)
Next diff →

Current revision



ATGGTTCTGTCTGAAGGTGAATGGCAGCTGGTTCTGCATGTTTGGGCTAAAGTTGAAGCTGACGTCGCTGGTCATGGTCAGGACATCTTGATTCGACTGTTCAAATCTCATCCGGAAACTCTGGAAAAATTCGATCGTTTCAAACATCTGAAAACTGAAGCTGAAATGAAAGCTTCTGAAGATCTGAAAAAACATGGTGTTACCGTGTTAACTGCCCTAGGTGCTATCCTTAAGAAAAAAGGGCATCATGAAGCTGAGCTCAAACCGCTTGCGCAATCGCATGCTACTAAACATAAGATCCCGATCAAATACCTGGAATTCATCTCTGAAGCGATCATCCATGTTCTGCATTCTAGACATCCAGGTGACTTCGGTGCTGACGCTCAGGGTGCTATGAACAAAGCTCTCGAGCTGTTCCGTAAAGATATCGCTGCTAAGTACAAAGAACTGGGTTACCAGGGTTAATGA

Personal tools