Hartings AU Photosynthesis Lab:Materials/WT Sequence text

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(New page: {{Template:Hartings AU Photosynthesis Lab}} ATGGTTCTGTCTGAAGGTGAATGGCAGCTGGTTCTGCATGTTTGGGCTAAAGTTGAAGCTGAC GTCGCTGGTCATGGTCAGGACATCTTGATTCGACTGTTCAAATCTCATCCGGAAACTCTGGAAAAATTCGATCGTTTC...)
Line 1: Line 1:
{{Template:Hartings AU Photosynthesis Lab}}
{{Template:Hartings AU Photosynthesis Lab}}
-
ATGGTTCTGTCTGAAGGTGAATGGCAGCTGGTTCTGCATGTTTGGGCTAAAGTTGAAGCTGAC
+
ATGGTTCTGTCTGAAGGTGAATGGCAGCTGGTTCTGCATGTTTGGGCTAAAGTTGAAGCTGACGTCGCTGGTCATGGTCAGGACATCTTGATTCGACTGTTCAAATCTCATCCGGAAACTCTGGAAAAATTCGATCGTTTCAAACATCTGAAAACTGAAGCTGAAATGAAAGCTTCTGAAGATCTGAAAAAACATGGTGTTACCGTGTTAACTGCCCTAGGTGCTATCCTTAAGAAAAAAGGGCATCATGAAGCTGAGCTCAAACCGCTTGCGCAATCGCATGCTACTAAACATAAGATCCCGATCAAATACCTGGAATTCATCTCTGAAGCGATCATCCATGTTCTGCATTCTAGACATCCAGGTGACTTCGGTGCTGACGCTCAGGGTGCTATGAACAAAGCTCTCGAGCTGTTCCGTAAAGATATCGCTGCTAAGTACAAAGAACTGGGTTACCAGGGTTAATGA
-
GTCGCTGGTCATGGTCAGGACATCTTGATTCGACTGTTCAAATCTCATCCGGAAACTCTGGAAAAATTCGATCGTTTCAAACATCTGAAAACTGAAGCTGAAATGAAAGCTTCTGAAGATCTGAAAAAACATGGTGTTACCGTGTTAACTGCCCTAGGTGCTATCCTTAAGAAAAAAGGGCATCATGAAGCTGAGCTCAAACCGCTTGCGCAATCGCATGCTACTAAACATAAGATCCCGATCAAATACCTGGAATTCATCTCTGAAGCGATCATCCATGTTCTGCATTCTAGACATCCAGGTGACTTCGGTGCTGACGCTCAGGGTGCTATGAACAAAGCTCTCGAGCTGTTCCGTAAAGATATCGCTGCTAAGTACAAAGAACTGGGTTACCAGGGTTAATGA
+

Revision as of 15:49, 14 January 2013



ATGGTTCTGTCTGAAGGTGAATGGCAGCTGGTTCTGCATGTTTGGGCTAAAGTTGAAGCTGACGTCGCTGGTCATGGTCAGGACATCTTGATTCGACTGTTCAAATCTCATCCGGAAACTCTGGAAAAATTCGATCGTTTCAAACATCTGAAAACTGAAGCTGAAATGAAAGCTTCTGAAGATCTGAAAAAACATGGTGTTACCGTGTTAACTGCCCTAGGTGCTATCCTTAAGAAAAAAGGGCATCATGAAGCTGAGCTCAAACCGCTTGCGCAATCGCATGCTACTAAACATAAGATCCCGATCAAATACCTGGAATTCATCTCTGAAGCGATCATCCATGTTCTGCATTCTAGACATCCAGGTGACTTCGGTGCTGACGCTCAGGGTGCTATGAACAAAGCTCTCGAGCTGTTCCGTAAAGATATCGCTGCTAAGTACAAAGAACTGGGTTACCAGGGTTAATGA

Personal tools