Harvard:Biophysics 101/2007/Notebook:Christopher Nabel/2007-3-15

Task 1

What I Found

This sequence is an allelic variation on a portion of the gene HtrA1, a serine peptidase implicated in wet Age-Related Macular Degeneration and tumor suppression.

What I Did

First, I fumbled around on the NCBI Website trying to find the best interface to online databases for finding our sequence in the genome. This led me to BLAST, which allowed me to enter a sequence (even an unformatted one) for search against the entire human genome. This returned a clear match: a contig on chromosome 10.

Specifically, BLAST reports the matching sequence in the genome, and aligns our search sequence with this reference sequence. It returns an alignment, and this alignment tells us that we have an A for G substitution at position 201 in reference to the start of our query sequence.

As for matching gene products, BLAST reports two flanking regions. The first is a hypothetical protein to the 5’ region, which isn’t of the most use to us (though it may at some future day be important). In the 3’ direction, however, we find a match with HtrA Serine Peptidase 1

I don’t know what this is, so I first searched PubMed for the gene. There are two big topics that have emerged in the literature for this protein. The first is a suggestion that HtrA1 may be a tumor suppressor gene. The second is an implication of HtrA1 in wet Age-related Macular Degeneration. These are the two clinical considerations to hold in mind as we consider the sole mutation observed.

To see if our allelic variation has ever been observed before, I went to OMIM and searched by HrtA1. I found one entry, which listed one allelic variation: a G to A mutation at position 512. After cross referencing between the GenBank entry and our reference sequence, I realized our very queried SNP was entered in a SNP database.

I then Wikipedia-ed AGM to learn more about this disease and the cautions you can take against it. There are several recommendations I would make based on this page (I should probably get a Medical Degree to do this portion of the assignment correctly…)

What Would I Do?

As far as I’m concerned, I would address the concerns of the macular degeneration first. Wet AGM is caused by excessive blood vessel growth under the macula. I would recommend three environmental changes: stop smoking (if you do), reduce the fat intake in your diet, and wear UV-protective sunglasses outdoors (often). These are environmental factors that could play a role in staving off AMD, according to the literature. An additional study has shown that taking your vitamins can also cut this disease off at the pass. Lastly, if the patient is concerned, I would alert him/her to the option of new and unproven drug therapies for this disease. Perhaps, if they start to notice symptoms, they should consider this as an option in early-stage degeneration.

Second, since this protein is a supposed tumor suppressor, I would check the patient for various cancers. Perhaps there is data we can collect about the frequency of this allele in the emergence of tissue specific cancers (the literature seems to implicate lung and ovarian cancer). I would test the individual mainly to confirm that they are ok, but also track this SNP as the patient grows older and see if any other disorders emerge.

Task 2

If you found this sequence in your patient, what would you do?

GGAAAAATTACAGACCTTGGATCTCTGAGACAATGCTCTTACAACCATTCA