Harvard:Biophysics 101/2007/Notebook:Denizkural/2007-3-15: Difference between revisions
Denizkural (talk | contribs) mNo edit summary |
Denizkural (talk | contribs) No edit summary |
||
Line 1: | Line 1: | ||
==Challenge Sequence== | |||
What is the significance of this sequence? | |||
<pre> | |||
ctgcggaggctgctgcaggagagggagcttgtggagcctcttacacccagtggagaagct | |||
cccaaccaagctctcttgaggatcttgaaggaaactgaattcaaaaagatcaaagtgctg | |||
tgctccggtgcgttcggcacggtgtataagggactctggatcccagaaggtgagaaagtt | |||
aaaattcccg | |||
</pre> | |||
==Manual Analysis== | ==Manual Analysis== | ||
Revision as of 03:19, 15 March 2007
Challenge Sequence
What is the significance of this sequence?
ctgcggaggctgctgcaggagagggagcttgtggagcctcttacacccagtggagaagct cccaaccaagctctcttgaggatcttgaaggaaactgaattcaaaaagatcaaagtgctg tgctccggtgcgttcggcacggtgtataagggactctggatcccagaaggtgagaaagtt aaaattcccg
Manual Analysis
First, I did a blast search with the new beta version, with the results:
>ref|NT_030059.12|Hs10_30314 Download subject sequence spanning the HSP Homo sapiens chromosome 10 genomic contig, reference assembly Length=44617998 Features flanking this part of subject sequence: 3895 bp at 5' side: hypothetical protein 425 bp at 3' side: HtrA serine peptidase 1 Score = 736 bits (398), Expect = 0.0 Identities = 400/401 (99%), Gaps = 0/401 (0%) Strand=Plus/Plus Query 1 CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 42968870 CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG 42968929 Query 61 CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 42968930 CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA 42968989 Query 121 CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 42968990 CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC 42969049 Query 181 CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT 240 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct 42969050 CGCGGACGCTGCCTTCGTCCGGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT 42969109 Query 241 ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 42969110 ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG 42969169 Query 301 CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 42969170 CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC 42969229 Query 361 GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC 401 |||||||||||||||||||||||||||||||||||||||||
We observe one SNP between 181 and 240 on our query, as you can see above.
And then, we follow the link to the HtrA, which gives a link to OMIM #610149, which is describes how a certain SNP increases risk for Macular age-related macular degeneration, and provides an SNP reference, so we view the SNP:
http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=rs11200638
which corresponds to the SNP we identified with BLAST.
Lay-person recommendation
Inform them that they are at a higher risk for age-related macular degeneration due to a rare mutation. If the person is of Asian origin however, I would double-check my results. Then I would refer them to a specialist on age-related macular degeneration, and ask them if their relatives had this problem in old age.