Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 40: Line 40:
<pre>
<pre>
>my_sequence                                                                       
>my_sequence                                                                       
-
CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG                   
+
CTGTGTCTGT AAACTGATGG CTAACAAAAC TAGGATTTTG GTCACTTCTA AAATGGAACA TTTAAAGAAA GCTGACAAAA TATTAATTTT GCATGAAGGT AGCAGCTATT TTTATGGGAC ATTTTCAGAA CTCCAAAATC TACAGCCAGA CTTTAGCTCA AAACTCATGG GATGTGATTC TTTCGACCAA TTTAGTGCAG AAAGAAGAAA TTCAATCCTA ACTGAGACCT TACACCGTTT CTCATTAGAA GGAGATGCTC CTGTCTCCTG GACAGAAACA AAAAAACAAT CTTTTAAACA GACTGGAGAG TTTGGGGAAA AAAGGAAGAA TTCTATTCTC AATCCAATCA ACTCTATACG AAAATTTTCC ATTGTGCAAA AGACTCCCTT ACAAATGAAT GGCATCGAAG AGGATTCTGA TGAGCCTTTA GAGAGAAGGC TGTCCTTAGT ACCAGATTCT GAGCAGGGAG AGGCGATACT GCCTCGCATC AGCGTGATCA GCACTGGCCC CACGCTTCAG GCACGAAGGA GGCAGTCTGT CCTGAACCTG ATGACACACT CAGTTAACCA AGGTCAGAAC ATTCACCGAA AGACAACAGC ATCCACACGA AAAGTGTCAC TGGCCCCTCA GGCAAACTTG ACTGAACTGG ATATATATTC AAGAAGGTTA TCTCAAGAAA CTGGCTTGGA AATAAGTGAA GAAATTAACG AAGAAGACTT
-
CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA                   
+
-
CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC                   
+
-
CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT                   
+
-
ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG                   
+
-
CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC                   
+
-
GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGCAAA
+
</pre>
</pre>

Revision as of 00:19, 16 March 2007

Just realized this should be private, so STOP reading if you haven't done it yet, since it's sort of too late to erase as its cached in history.

  • NT_030059.12 Homo sapiens chromosome 10 genomic contig
  • mutation G to A at position 201
  • used BLAST to figure out which gene and which mutation
  • because of where the start codon is, the mutation is CGG to CAG... arginine to glutamine. This probably is not too big a deal, but I don't know anything about proteins really so I'm not sure.
  • search OMIM - didn't really find anything but not sure I totally understand all the resources available in OMIM
Query  1         CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG  60
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42968870  CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG  42968929

Query  61        CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA  120
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42968930  CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA  42968989

Query  121       CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC  180
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42968990  CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC  42969049

Query  181       CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT  240
                 |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct  42969050  CGCGGACGCTGCCTTCGTCCGGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT  42969109

Query  241       ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG  300
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42969110  ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG  42969169

Query  301       CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC  360
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42969170  CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC  42969229

Query  361       GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC  401
                 |||||||||||||||||||||||||||||||||||||||||
Sbjct  42969230  GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC  42969270

Task2

>my_sequence                                                                      
CTGTGTCTGT AAACTGATGG CTAACAAAAC TAGGATTTTG GTCACTTCTA AAATGGAACA TTTAAAGAAA GCTGACAAAA TATTAATTTT GCATGAAGGT AGCAGCTATT TTTATGGGAC ATTTTCAGAA CTCCAAAATC TACAGCCAGA CTTTAGCTCA AAACTCATGG GATGTGATTC TTTCGACCAA TTTAGTGCAG AAAGAAGAAA TTCAATCCTA ACTGAGACCT TACACCGTTT CTCATTAGAA GGAGATGCTC CTGTCTCCTG GACAGAAACA AAAAAACAAT CTTTTAAACA GACTGGAGAG TTTGGGGAAA AAAGGAAGAA TTCTATTCTC AATCCAATCA ACTCTATACG AAAATTTTCC ATTGTGCAAA AGACTCCCTT ACAAATGAAT GGCATCGAAG AGGATTCTGA TGAGCCTTTA GAGAGAAGGC TGTCCTTAGT ACCAGATTCT GAGCAGGGAG AGGCGATACT GCCTCGCATC AGCGTGATCA GCACTGGCCC CACGCTTCAG GCACGAAGGA GGCAGTCTGT CCTGAACCTG ATGACACACT CAGTTAACCA AGGTCAGAAC ATTCACCGAA AGACAACAGC ATCCACACGA AAAGTGTCAC TGGCCCCTCA GGCAAACTTG ACTGAACTGG ATATATATTC AAGAAGGTTA TCTCAAGAAA CTGGCTTGGA AATAAGTGAA GAAATTAACG AAGAAGACTT
Personal tools