Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-5
From OpenWetWare
The Project Thus Far
Our project consists of a number of parts. Its central feature takes a DNA sequence and uses BLAST/SNP to determine whether or not the sequence has any single nucleotide polymorphisms in it. The next part of the project takes those results and does a PubMed search to find related literature on the disease. We are currently working on a webapp to make this all much easier for the user.
SNP lookup
This is largely thanks to Xiaodi, and in fact this write-up is pulled from his page... The script so far. Feel free to comment on discussion page.
Input (example.fasta):
>example1 CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC
Output (to screen):
Sequence received; please wait.
2 single nucleotide polymorphism(s) found:
rs11200638
rs2672598
----------------------------------------
rs11200638 details:
MACULAR DEGENERATION, AGE-RELATED, 7
HTRA1, -512G-A
{3:DeWan et al. (2006)} identified a SNP ({dbSNP rs11200638}) for which
homozygosity for the AA genotype results in a 10-fold (confidence
intervals 4.38 to 22.82) increased risk of wet age-related macular
degeneration (see ARMD7, {610149}) in a Southeast Asian population
identified in Hong Kong. {5:Yang et al. (2006)} independently identified
this variant as conferring risk in a Caucasian cohort from Utah.
----------------------------------------
No information found for rs2672598
Script (snp.py): <syntax type='python'> from Bio import SeqIO from Bio.Blast import NCBIWWW from Bio.EUtils import DBIdsClient import xml.dom.minidom from xml.dom.minidom import parse, parseString from threading import Thread import time, sys
- C-style struct to pass parameters
class AllelicVariant: pass
- basic function to open fasta file and get sequence
def get_sequence_from_fasta(file): file_handle = open(file) records = SeqIO.parse(file_handle, format="fasta") record = records.next() return record.seq.data
- lookup blast snp data
def blast_snp_lookup(seq): result_handle = NCBIWWW.qblast("blastn", "snp/human_9606/human_9606", seq) return result_handle.read()
- basic text extraction from XML; based on http://docs.python.org/lib/dom-example.html
def get_text(node_list):
rc = ""
for node in node_list:
if node.nodeType == node.TEXT_NODE:
rc = rc + node.data
return rc
- extracts snp data
def extract_snp_data(str): dom = parseString(str) variants = dom.getElementsByTagName("Hit") if len(variants) == 0: return parsed = [] for v in variants: # now populate the struct id = get_text(v.getElementsByTagName("Hit_accession")[0].childNodes) score = get_text(v.getElementsByTagName("Hsp_score")[0].childNodes) # only consider it a genuine snp if the hit score is above 100 if int(score) > 100: parsed.append(id) return parsed
- queries the database and returns all info in an XML format
def omim_snp_search(dnsnp_id): client = DBIdsClient.DBIdsClient() query = client.search(dnsnp_id, "omim") records = [i.efetch(rettype="xml") for i in query] return records
- extracts allelic variant data, as the name implies, using the struct above
def extract_allelic_variant_data(str): dom = parseString(str) variants = dom.getElementsByTagName("Mim-allelic-variant") if len(variants) == 0: return parsed = [] for v in variants: a = AllelicVariant() # create empty instance of struct # now populate the struct a.name = get_text(v.getElementsByTagName("Mim-allelic-variant_name")[0].childNodes) a.mutation = get_text(v.getElementsByTagName("Mim-allelic-variant_mutation")[0].getElementsByTagName("Mim-text_text")[0].childNodes) a.description = get_text(v.getElementsByTagName("Mim-allelic-variant_description")[0].getElementsByTagName("Mim-text_text")[0].childNodes) parsed.append(a) return parsed
- BEGIN ACTUAL PROGRAM
- read sequence from file
sequence = get_sequence_from_fasta("example.fasta") print "Sequence received; please wait."
- look up data
b = blast_snp_lookup(sequence)
- extract data
e = extract_snp_data(b) print str(len(e)) + " single nucleotide polymorphism(s) found:" if len(e) > 0: for snp_id in e: print snp_id else: print "[none]" sys.exit() # nothing more to be done if no snp found print '-' * 40
- do an omim search on each snp
for snp_id in e: o = omim_snp_search(snp_id) if len(o) == 0: print "No information found for " + snp_id continue # nothing more to be done if no records can be found # otherwise, find the allelic variant data print snp_id + " details:" for i in o: v = extract_allelic_variant_data(i.read()) if v != None: for a in v: print a.name print a.mutation print a.description print '-' * 40 </syntax>


