Harvard:Biophysics 101/2007/Notebook:Michael Wang/2007-2-13

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
I've managed to figure out how to get clustal working (or at least executing on a windows machine). These steps are from Shawn.  I've just pasted them here for convenience.  Code will follow shortly. 
+
For anyone still trying to get clustalw working on a PC after reading the link [http://openwetware.org/wiki/Talk:Harvard:Biophysics_101/2007/02/13/install-clustalw#Windows here], the key seems to be making sure that clustalw works from the command line. Even if you set it up properly, any problems in the actual call will give you the same error as if you didn't set it up properly. The only thing python cares about is whether or not the output file was created.
-
<pre>
+
-
From the desktop, right click My Computer and click properties.
+
-
In the System Properties window, click on the Advanced tab.
+
-
In the Advanced section, click the Environment Variables button.
+
-
Finally, in the Environment Variables window, highlight the path variable
+
-
in the Systems Variable section and click edit. Add or modify the path
+
-
lines with the paths you wish the computer to access. Each different
+
-
directory is separated with a semicolon as shown below.
+
-
C:\Program Files;C:\Winnt;C:\Winnt\System32
+
The current version of my code is not very intelligent on the analysis side. It currently sucks up all the fasta files in the ./import folder of the current directory and then compiles them into a single file.  This file is passed into clustalw for alignment. 
-
 
+
-
Add the directory containing clustalw to your path.
+
-
 
+
-
In other words, if you unzipped the clustalw zip file into C:\Documents and Settings\Mike\Desktop\clustalw,
+
-
your final path variable should look like:
+
-
 
+
-
C:\Program Files;C:\Winnt;C:\Winnt\System32; C:\Documents and Settings\Mike\Desktop\clustalw
+
-
 
+
-
In your actual program, you can call clustalw with the following code (also from Shawn)
+
 +
<pre>
#!/usr/bin/env python
#!/usr/bin/env python
Line 25: Line 9:
from Bio import Clustalw
from Bio import Clustalw
-
cline = Clustalw.MultipleAlignCL(os.path.join(os.curdir, 'apoe.fasta'))
+
#This first section of code merges all fasta files located in the input folder of curdir
 +
#into a single file called all.fasta
 +
input_list = list(os.listdir(os.path.join(os.curdir,'input')))
 +
print input_list
 +
merged_file = open(os.path.join(os.curdir, 'all.fasta'),"w")
 +
print os.path.join(os.curdir, 'all.fasta')
 +
for i in input_list:
 +
        print "loading ", os.path.join(os.curdir,'input\\',i)
 +
        current_file = open(os.path.join(os.curdir,'input\\',i),"r")
 +
        all_lines = current_file.readlines()
 +
        merged_file.writelines(all_lines)
 +
        current_file.close()
 +
        merged_file.write("\n\n")
 +
print "done making file"
 +
merged_file.close()
 +
 
 +
#Once the merged file has been created, it is passed into the alignment program
 +
cline = Clustalw.MultipleAlignCL(os.path.join(os.curdir, 'all.fasta'))
cline.set_output('test.aln')
cline.set_output('test.aln')
alignment = Clustalw.do_alignment(cline)
alignment = Clustalw.do_alignment(cline)
 +
all_records = alignment.get_all_seqs()
 +
 +
print alignment
 +
</pre>
 +
 +
I have yet to write code to do counts of say, how many frameshift mutations there are, etc.  It just prints the raw alignment for now.
 +
 +
Using a test files uploaded [[Media:apoe.fasta]] and [[Media:Copy of apoe.fasta]], the following output is generated.
 +
 +
<pre>
 +
loading  .\input\apoe.fasta
 +
loading  .\input\Copy of apoe.fasta
 +
done making file
 +
CLUSTAL X (1.81) multiple sequence alignment
 +
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      CGCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCAC
 +
gi|189350|gb|K10296.1|HUMAPOE3      CGCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCAC
 +
gi|178850|gb|K00396.1|HUMAPOE3      CGCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCAC
 +
gi|178843|gb|K06396.1|HUMAPOE3      CGCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCAC
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      AGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGG
 +
gi|189350|gb|K10296.1|HUMAPOE3      AGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGG
 +
gi|178850|gb|K00396.1|HUMAPOE3      AGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGG
 +
gi|178843|gb|K06396.1|HUMAPOE3      AGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGG
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      CAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCC
 +
gi|189350|gb|K10296.1|HUMAPOE3      CAGGATGCCAGGCCAAGGTGGAG--GGCGGTGGAGACAGAGCCGGAGCCC
 +
gi|178850|gb|K00396.1|HUMAPOE3      CAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCC
 +
gi|178843|gb|K06396.1|HUMAPOE3      CAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCC
 +
                                    ***********************  ************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      GAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGC
 +
gi|189350|gb|K10296.1|HUMAPOE3      GAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGC
 +
gi|178850|gb|K00396.1|HUMAPOE3      GAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGC
 +
gi|178843|gb|K06396.1|HUMAPOE3      GAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGC
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      ACTGGGTCGCTTTTGGGATTAATCCTGCGCTGGGTGCAGACACTGTCTGA
 +
gi|189350|gb|K10296.1|HUMAPOE3      ACTGGGTCGCTTTTGGGATTAATCCTGCGCTGGGTGCAGACACTGTCTGA
 +
gi|178850|gb|K00396.1|HUMAPOE3      ACTGGGTCGCTTTTGGGATTA--CCTGCGCTGGGTGCAGACACTGTCTGA
 +
gi|178843|gb|K06396.1|HUMAPOE3      ACTGGGTCGCTTTTGGGATTA--CCTGCGCTGGGTGCAGACACTGTCTGA
 +
                                    *********************  ***************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      GCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGG
 +
gi|189350|gb|K10296.1|HUMAPOE3      GCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGG
 +
gi|178850|gb|K00396.1|HUMAPOE3      GCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGG
 +
gi|178843|gb|K06396.1|HUMAPOE3      GCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGG
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      CGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTG
 +
gi|189350|gb|K10296.1|HUMAPOE3      CGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTG
 +
gi|178850|gb|K00396.1|HUMAPOE3      CGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTG
 +
gi|178843|gb|K06396.1|HUMAPOE3      CGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTG
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      GAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAA
 +
gi|189350|gb|K10296.1|HUMAPOE3      GAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAA
 +
gi|178850|gb|K00396.1|HUMAPOE3      GAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAA
 +
gi|178843|gb|K06396.1|HUMAPOE3      GAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAA
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      GGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGT
 +
gi|189350|gb|K10296.1|HUMAPOE3      GGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGT
 +
gi|178850|gb|K00396.1|HUMAPOE3      GGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGT
 +
gi|178843|gb|K06396.1|HUMAPOE3      GGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGT
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      GCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAG
 +
gi|189350|gb|K10296.1|HUMAPOE3      GCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAG
 +
gi|178850|gb|K00396.1|HUMAPOE3      GCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAG
 +
gi|178843|gb|K06396.1|HUMAPOE3      GCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAG
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      AGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCG
 +
gi|189350|gb|K10296.1|HUMAPOE3      AGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCG
 +
gi|178850|gb|K00396.1|HUMAPOE3      AGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCG
 +
gi|178843|gb|K06396.1|HUMAPOE3      AGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCG
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      TAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGT
 +
gi|189350|gb|K10296.1|HUMAPOE3      TAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGT
 +
gi|178850|gb|K00396.1|HUMAPOE3      TAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGT
 +
gi|178843|gb|K06396.1|HUMAPOE3      TAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGT
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      ACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGC
 +
gi|189350|gb|K10296.1|HUMAPOE3      ACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGC
 +
gi|178850|gb|K00396.1|HUMAPOE3      ACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGC
 +
gi|178843|gb|K06396.1|HUMAPOE3      ACCAT-------CCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGC
 +
                                    ****        **************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      GAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGT
 +
gi|189350|gb|K10296.1|HUMAPOE3      GAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGT
 +
gi|178850|gb|K00396.1|HUMAPOE3      GAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGT
 +
gi|178843|gb|K06396.1|HUMAPOE3      GAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGT
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      GGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCG
 +
gi|189350|gb|K10296.1|HUMAPOE3      GGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCG
 +
gi|178850|gb|K00396.1|HUMAPOE3      GGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCG
 +
gi|178843|gb|K06396.1|HUMAPOE3      GGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCG
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      AGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGC
 +
gi|189350|gb|K10296.1|HUMAPOE3      AGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGC
 +
gi|178850|gb|K00396.1|HUMAPOE3      AGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGC
 +
gi|178843|gb|K06396.1|HUMAPOE3      AGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGC
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      CTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGA
 +
gi|189350|gb|K10296.1|HUMAPOE3      CTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGA
 +
gi|178850|gb|K00396.1|HUMAPOE3      CTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGA
 +
gi|178843|gb|K06396.1|HUMAPOE3      CTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGA
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      GCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCA
 +
gi|189350|gb|K10296.1|HUMAPOE3      GCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCA
 +
gi|178850|gb|K00396.1|HUMAPOE3      GCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCA
 +
gi|178843|gb|K06396.1|HUMAPOE3      GCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCA
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      AGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGG
 +
gi|189350|gb|K10296.1|HUMAPOE3      AGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGG
 +
gi|178850|gb|K00396.1|HUMAPOE3      AGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGG
 +
gi|178843|gb|K06396.1|HUMAPOE3      AGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGG
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      CTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCC
 +
gi|189350|gb|K10296.1|HUMAPOE3      CTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCC
 +
gi|178850|gb|K00396.1|HUMAPOE3      CTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCC
 +
gi|178843|gb|K06396.1|HUMAPOE3      CTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCC
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      CAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCA
 +
gi|189350|gb|K10296.1|HUMAPOE3      CAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCA
 +
gi|178850|gb|K00396.1|HUMAPOE3      CAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCA
 +
gi|178843|gb|K06396.1|HUMAPOE3      CAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCA
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      CCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCG
 +
gi|189350|gb|K10296.1|HUMAPOE3      CCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCG
 +
gi|178850|gb|K00396.1|HUMAPOE3      CCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCG
 +
gi|178843|gb|K06396.1|HUMAPOE3      CCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCG
 +
                                    **************************************************
 +
 +
gi|178350|gb|K00296.1|HUMAPOE3      CCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAG
 +
gi|189350|gb|K10296.1|HUMAPOE3      CCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAG
 +
gi|178850|gb|K00396.1|HUMAPOE3      CCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAG
 +
gi|178843|gb|K06396.1|HUMAPOE3      CCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAG
 +
                                    **************************************************
-
I hope this helps
+
gi|178350|gb|K00296.1|HUMAPOE3      TTTCACGT
 +
gi|189350|gb|K10296.1|HUMAPOE3      TTTCACGT
 +
gi|178850|gb|K00396.1|HUMAPOE3      TTTCACGC
 +
gi|178843|gb|K06396.1|HUMAPOE3      TTTCACGC
 +
                                    *******
</pre>
</pre>
 +
Each of the two files contains two sequences (I made fake changes to each).

Revision as of 00:07, 20 February 2007

For anyone still trying to get clustalw working on a PC after reading the link here, the key seems to be making sure that clustalw works from the command line. Even if you set it up properly, any problems in the actual call will give you the same error as if you didn't set it up properly. The only thing python cares about is whether or not the output file was created.

The current version of my code is not very intelligent on the analysis side. It currently sucks up all the fasta files in the ./import folder of the current directory and then compiles them into a single file. This file is passed into clustalw for alignment.

#!/usr/bin/env python

import os
from Bio import Clustalw

#This first section of code merges all fasta files located in the input folder of curdir
#into a single file called all.fasta
input_list = list(os.listdir(os.path.join(os.curdir,'input')))
print input_list
merged_file = open(os.path.join(os.curdir, 'all.fasta'),"w")
print os.path.join(os.curdir, 'all.fasta')
for i in input_list:
        print "loading ", os.path.join(os.curdir,'input\\',i)
        current_file = open(os.path.join(os.curdir,'input\\',i),"r")
        all_lines = current_file.readlines()
        merged_file.writelines(all_lines)
        current_file.close()
        merged_file.write("\n\n")
print "done making file"
merged_file.close()

#Once the merged file has been created, it is passed into the alignment program
cline = Clustalw.MultipleAlignCL(os.path.join(os.curdir, 'all.fasta'))
cline.set_output('test.aln')
alignment = Clustalw.do_alignment(cline)
all_records = alignment.get_all_seqs()

print alignment 

I have yet to write code to do counts of say, how many frameshift mutations there are, etc. It just prints the raw alignment for now.

Using a test files uploaded Media:apoe.fasta and Media:Copy of apoe.fasta, the following output is generated.

loading  .\input\apoe.fasta
loading  .\input\Copy of apoe.fasta
done making file
CLUSTAL X (1.81) multiple sequence alignment


gi|178350|gb|K00296.1|HUMAPOE3      CGCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCAC
gi|189350|gb|K10296.1|HUMAPOE3      CGCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCAC
gi|178850|gb|K00396.1|HUMAPOE3      CGCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCAC
gi|178843|gb|K06396.1|HUMAPOE3      CGCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCAC
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      AGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGG
gi|189350|gb|K10296.1|HUMAPOE3      AGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGG
gi|178850|gb|K00396.1|HUMAPOE3      AGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGG
gi|178843|gb|K06396.1|HUMAPOE3      AGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGG
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      CAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCC
gi|189350|gb|K10296.1|HUMAPOE3      CAGGATGCCAGGCCAAGGTGGAG--GGCGGTGGAGACAGAGCCGGAGCCC
gi|178850|gb|K00396.1|HUMAPOE3      CAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCC
gi|178843|gb|K06396.1|HUMAPOE3      CAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCC
                                    ***********************   ************************

gi|178350|gb|K00296.1|HUMAPOE3      GAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGC
gi|189350|gb|K10296.1|HUMAPOE3      GAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGC
gi|178850|gb|K00396.1|HUMAPOE3      GAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGC
gi|178843|gb|K06396.1|HUMAPOE3      GAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGC
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      ACTGGGTCGCTTTTGGGATTAATCCTGCGCTGGGTGCAGACACTGTCTGA
gi|189350|gb|K10296.1|HUMAPOE3      ACTGGGTCGCTTTTGGGATTAATCCTGCGCTGGGTGCAGACACTGTCTGA
gi|178850|gb|K00396.1|HUMAPOE3      ACTGGGTCGCTTTTGGGATTA--CCTGCGCTGGGTGCAGACACTGTCTGA
gi|178843|gb|K06396.1|HUMAPOE3      ACTGGGTCGCTTTTGGGATTA--CCTGCGCTGGGTGCAGACACTGTCTGA
                                    *********************  ***************************

gi|178350|gb|K00296.1|HUMAPOE3      GCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGG
gi|189350|gb|K10296.1|HUMAPOE3      GCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGG
gi|178850|gb|K00396.1|HUMAPOE3      GCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGG
gi|178843|gb|K06396.1|HUMAPOE3      GCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGG
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      CGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTG
gi|189350|gb|K10296.1|HUMAPOE3      CGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTG
gi|178850|gb|K00396.1|HUMAPOE3      CGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTG
gi|178843|gb|K06396.1|HUMAPOE3      CGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTG
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      GAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAA
gi|189350|gb|K10296.1|HUMAPOE3      GAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAA
gi|178850|gb|K00396.1|HUMAPOE3      GAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAA
gi|178843|gb|K06396.1|HUMAPOE3      GAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAA
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      GGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGT
gi|189350|gb|K10296.1|HUMAPOE3      GGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGT
gi|178850|gb|K00396.1|HUMAPOE3      GGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGT
gi|178843|gb|K06396.1|HUMAPOE3      GGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGT
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      GCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAG
gi|189350|gb|K10296.1|HUMAPOE3      GCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAG
gi|178850|gb|K00396.1|HUMAPOE3      GCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAG
gi|178843|gb|K06396.1|HUMAPOE3      GCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAG
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      AGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCG
gi|189350|gb|K10296.1|HUMAPOE3      AGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCG
gi|178850|gb|K00396.1|HUMAPOE3      AGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCG
gi|178843|gb|K06396.1|HUMAPOE3      AGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCG
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      TAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGT
gi|189350|gb|K10296.1|HUMAPOE3      TAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGT
gi|178850|gb|K00396.1|HUMAPOE3      TAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGT
gi|178843|gb|K06396.1|HUMAPOE3      TAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGT
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      ACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGC
gi|189350|gb|K10296.1|HUMAPOE3      ACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGC
gi|178850|gb|K00396.1|HUMAPOE3      ACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGC
gi|178843|gb|K06396.1|HUMAPOE3      ACCAT-------CCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGC
                                    ****        **************************************

gi|178350|gb|K00296.1|HUMAPOE3      GAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGT
gi|189350|gb|K10296.1|HUMAPOE3      GAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGT
gi|178850|gb|K00396.1|HUMAPOE3      GAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGT
gi|178843|gb|K06396.1|HUMAPOE3      GAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGT
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      GGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCG
gi|189350|gb|K10296.1|HUMAPOE3      GGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCG
gi|178850|gb|K00396.1|HUMAPOE3      GGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCG
gi|178843|gb|K06396.1|HUMAPOE3      GGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCG
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      AGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGC
gi|189350|gb|K10296.1|HUMAPOE3      AGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGC
gi|178850|gb|K00396.1|HUMAPOE3      AGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGC
gi|178843|gb|K06396.1|HUMAPOE3      AGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGC
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      CTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGA
gi|189350|gb|K10296.1|HUMAPOE3      CTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGA
gi|178850|gb|K00396.1|HUMAPOE3      CTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGA
gi|178843|gb|K06396.1|HUMAPOE3      CTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGA
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      GCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCA
gi|189350|gb|K10296.1|HUMAPOE3      GCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCA
gi|178850|gb|K00396.1|HUMAPOE3      GCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCA
gi|178843|gb|K06396.1|HUMAPOE3      GCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCA
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      AGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGG
gi|189350|gb|K10296.1|HUMAPOE3      AGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGG
gi|178850|gb|K00396.1|HUMAPOE3      AGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGG
gi|178843|gb|K06396.1|HUMAPOE3      AGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGG
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      CTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCC
gi|189350|gb|K10296.1|HUMAPOE3      CTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCC
gi|178850|gb|K00396.1|HUMAPOE3      CTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCC
gi|178843|gb|K06396.1|HUMAPOE3      CTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCC
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      CAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCA
gi|189350|gb|K10296.1|HUMAPOE3      CAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCA
gi|178850|gb|K00396.1|HUMAPOE3      CAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCA
gi|178843|gb|K06396.1|HUMAPOE3      CAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCA
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      CCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCG
gi|189350|gb|K10296.1|HUMAPOE3      CCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCG
gi|178850|gb|K00396.1|HUMAPOE3      CCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCG
gi|178843|gb|K06396.1|HUMAPOE3      CCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCG
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      CCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAG
gi|189350|gb|K10296.1|HUMAPOE3      CCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAG
gi|178850|gb|K00396.1|HUMAPOE3      CCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAG
gi|178843|gb|K06396.1|HUMAPOE3      CCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAG
                                    **************************************************

gi|178350|gb|K00296.1|HUMAPOE3      TTTCACGT
gi|189350|gb|K10296.1|HUMAPOE3      TTTCACGT
gi|178850|gb|K00396.1|HUMAPOE3      TTTCACGC
gi|178843|gb|K06396.1|HUMAPOE3      TTTCACGC
                                    *******

Each of the two files contains two sequences (I made fake changes to each).

Personal tools