Harvard:Biophysics 101/2007/Notebook:Michael Wang/2007-3-15

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search

Mdwang (Talk | contribs)
(New page: The first thing I did was identify the orfs in the sequence. I could use my orf function from the last assignment, but I did it manually and found a start codon at position 62 and a stop ...)
Next diff →

Revision as of 23:51, 14 March 2007

The first thing I did was identify the orfs in the sequence. I could use my orf function from the last assignment, but I did it manually and found a start codon at position 62 and a stop position at position 73 for a 7 Aa orf. Pretty short.

>example1 CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC


This is useless without some comparison so I blasted it.

Personal tools