Harvard:Biophysics 101/2007/Notebook:Michael Wang/2007-3-15

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(New page: The first thing I did was identify the orfs in the sequence. I could use my orf function from the last assignment, but I did it manually and found a start codon at position 62 and a stop ...)
Line 1: Line 1:
The first thing I did was identify the orfs in the sequence.  I could use my orf function from the last assignment, but I did it manually and found a start codon at position 62 and a stop position at position 73 for a 7 Aa orf.  Pretty short.   
The first thing I did was identify the orfs in the sequence.  I could use my orf function from the last assignment, but I did it manually and found a start codon at position 62 and a stop position at position 73 for a 7 Aa orf.  Pretty short.   
-
>example1                                                                    
+
>example1 <BR>                                                                   
-
CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG                     
+
CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG<BR>                    
-
C'''ATG'''CCACCCACAACAACTTTT'''TAA'''AAGAATCAGACGTGTGAAGGATTCTATTCGAATTA                     
+
C'''ATG'''CCACCCACAACAACTTTT'''TAA'''AAGAATCAGACGTGTGAAGGATTCTATTCGAATTA<BR>                    
-
CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC                     
+
CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC<BR>                    
-
CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT                     
+
CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT<BR>                    
-
ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG                     
+
ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG<BR>                    
-
CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC                     
+
CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC<BR>                    
-
GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC   
+
GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC<BR>    
This is useless without some comparison so I blasted it.
This is useless without some comparison so I blasted it.

Revision as of 23:51, 14 March 2007

The first thing I did was identify the orfs in the sequence. I could use my orf function from the last assignment, but I did it manually and found a start codon at position 62 and a stop position at position 73 for a 7 Aa orf. Pretty short.

>example1
CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG
CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA
CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC
CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT
ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG
CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC
GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC


This is useless without some comparison so I blasted it.

Personal tools