Harvard:Biophysics 101/2007/Notebook:Resmi Charalel/2007-3-15

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Task 1)
(Task 1)
Line 1: Line 1:
==Task 1==
==Task 1==
-
*Manual analysis of provided sequence:  CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGAC GTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCC TTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACG CCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCC
+
*Manual analysis of provided sequence:  CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGAC GTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCC TTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACG CCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCC CGGCGCTCCCACGCGAAGC  
-
CGGCGCTCCCACGCGAAGC  
+
**dsf
**dsf
***j
***j

Revision as of 15:55, 13 March 2007

Task 1

  • Manual analysis of provided sequence: CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGAC GTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCC TTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACG CCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCC CGGCGCTCCCACGCGAAGC
    • dsf
      • j
Personal tools