Harvard:Biophysics 101/2007/Notebook:Resmi Charalel/2007-3-15

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Task 1)
(Task 1)
Line 1: Line 1:
==Task 1==
==Task 1==
*Manual analysis of provided sequence:  CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGAC GTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCC TTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACG CCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCC CGGCGCTCCCACGCGAAGC  
*Manual analysis of provided sequence:  CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGAC GTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCC TTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACG CCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCC CGGCGCTCCCACGCGAAGC  
-
**dsf
+
**This sequence corresponds to Homo sapiens chromosome 10 genomic contig, reference assembly and contains a 1bp point mutation at position 201 of the given sequence, which corresponds to position 42969070 in reference sequence.
-
 
+
**The consequences of this mutation are that...
-
***j
+

Revision as of 15:46, 13 March 2007

Task 1

  • Manual analysis of provided sequence: CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGAC GTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCC TTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACG CCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCC CGGCGCTCCCACGCGAAGC
    • This sequence corresponds to Homo sapiens chromosome 10 genomic contig, reference assembly and contains a 1bp point mutation at position 201 of the given sequence, which corresponds to position 42969070 in reference sequence.
    • The consequences of this mutation are that...
Personal tools