Harvard:Biophysics 101/2007/Notebook:Xiaodi Wu/2007-3-15

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(more stuff)
m (formatting)
Line 12: Line 12:
'''First step:'''
'''First step:'''
-
Align this sequence on NCBI Blast. The result:
+
Align this sequence on NCBI Blast. The result is shown below.
<pre>
<pre>
>ref|NT_030059.12|Hs10_30314 Homo sapiens chromosome 10 genomic contig, reference assembly
>ref|NT_030059.12|Hs10_30314 Homo sapiens chromosome 10 genomic contig, reference assembly
Line 57: Line 57:
'''Second step:'''
'''Second step:'''
-
Look at genome browser to find where exactly this is: 10q25, bases 124210300 to 124210800
+
Look at the genome browser to find where exactly this is: 10q25, bases 124210300 to 124210800.
-
(Source: http://0-www.ncbi.nlm.nih.gov.library.vu.edu.au/mapview/maps.cgi?TAXID=9606&CHR=10&MAPS=rna,genes,cntg[124204783.56%3A124217283.44]-r&QUERY_NUMBER=1&RID=1173811506-1957-7708633758.BLASTQ2&GOTO=124210471.01human:10:bp&rsize=1562.484999999404 )
+
'''Third step:'''
'''Third step:'''

Revision as of 21:07, 13 March 2007

Input sequence:

>example1                                                                      
CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG                    
CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA                    
CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC                    
CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT                    
ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG                    
CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC                    
GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC

First step: Align this sequence on NCBI Blast. The result is shown below.

>ref|NT_030059.12|Hs10_30314 Homo sapiens chromosome 10 genomic contig, reference assembly
Length=44617998

 Features flanking this part of subject sequence:
   3895 bp at 5' side: hypothetical protein
   425 bp at 3' side: HtrA serine peptidase 1


 Score =  736 bits (398),  Expect = 0.0
 Identities = 400/401 (99%), Gaps = 0/401 (0%)
 Strand=Plus/Plus

Query  1         CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG  60
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42968870  CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG  42968929

Query  61        CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA  120
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42968930  CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA  42968989

Query  121       CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC  180
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42968990  CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC  42969049

Query  181       CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT  240
                 |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct  42969050  CGCGGACGCTGCCTTCGTCCGGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT  42969109

Query  241       ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG  300
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42969110  ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG  42969169

Query  301       CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC  360
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42969170  CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC  42969229

Query  361       GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC  401
                 |||||||||||||||||||||||||||||||||||||||||
Sbjct  42969230  GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC  42969270

Conclusion -- this sequence we have obtained is on chromosome 10, and there is one SNP apparent.

Second step: Look at the genome browser to find where exactly this is: 10q25, bases 124210300 to 124210800.

Third step: Look up SNPs at Entrez SNP (query: "10[CHR] AND 124210300:124210800[CHRPOS]") Two exist:

1: rs11200638 [Homo sapiens]
    AGCTCCGCGGACGCTGCCTTCGTCC[A/G]GCCGCAGAGGCCCCGCGGTCAGGGT

2: rs2672598 [Homo sapiens]
    CGCCGGACTGGGGGCCCGCCCGGGA[A/G]GCTCGGACTGGGCCGGGCAGGGACT

Fourth step: For the first SNP, we have A where the reference sequence has G. For the second SNP (which is on the minus strand), we have T as the complement, in agreement with the reference. Search OMIM to find out more about these loci (queries: "rs11200638" and "rs2672598")

Conclusions -- Homozygosity for the A allele in the case of the first SNP results in a tenfold increased risk of wet (neovascular) age-related macular degeneration. No information is available for the other locus.

Personal tools