Haynes:Making BioBricks

Making Standardized DNA Parts
Or, Less Expensive Alternatives to DNA Synthesis

By Karmella Haynes, 2012

First, identify a DNA “module” (e.g. promoter, coding region, etc.) and determine whether it contains any BioBrick cloning sites. If so, use site-directed mutagenesis or some other method to eliminate the sites without compromising the function of the module (e.g., silent mutation in a protein-coding sequence). Next, use one of the following methods to flank the module with BioBrick ends:

• Double-stranded Oligo Insert: A part that is smaller than ~85 bp can be made into an oligonucleotide insert.
• Overlapping Oligos: A part that is between ~ 85 - 150 bp can be assembled from smaller overlapping oligonucleotides.
• PCR Amplification: For a part that is larger than ~150 bp and is based on an existing DNA fragment, use PCR amplification of the existing DNA.

Double-stranded Oligo Insert

1. Design your oligos: An oligo insert should have a XbaI sticky end upstream of the part, SpeI and NotI sites downstream, and a PstI sticky end downstream.

Sense oligo:	5' CTAGA[coding sequence]ACTAGTAGCGGCCGCTGCA 3'
Anti-sense oligo:	5' GCGGCCGCTACTAGT[reverse complement of coding sequence]T 3'

Double stranded result:

5' ctaga [coding sequence] actagt a gcggccgctgca 3'
| ||||||||||||||||| |||||| | ||||||||
3' t [rev. comp. seq.] tgatca t cgccggcg 5'

2. Have the oligos synthesized (you can order through a company like www.idtdna.com).
Troubleshooting note: order the oligos with 5’ phosphates (optional) if you are having difficulty cloning.

3. Set up an annealing reaction as follows:

Sense oligo 1 (100 μM)	3.0 μl
Anti-sense oligo (100 μM)	3.0 μl
10x annealing buffer*	2.0 μl
dH2O	12.0 μl
nbsp;	50 μl

Heat at 100°C for 5 min., remove the entire heat block or water bath from the heat source, and allow to cool slowly to room temperature.
--> *10x annealing buffer: 1 M NaCl; 100 mM Tris-HCl, pH 7.4

4. If you need to calculate the amount of insert needed to set up a specific ratio of insert to vector for the ligation, use this formula to estimate ng/μl of the oligo insert:
[(total ng stock oligo 1 / μl dH2O used to dissolve dry oligo 1 + total ng stock oligo 2 / μl dH2O used to dissolve dry oligo 2) * 3 μl] / 20 μl

5. Ligate the double-stranded insert into a linearized vector with XbaI and PstI ends and transform into E. coli. (use any standard ligation/ transformation protocol)

Overlapping Oligos

1. Design your oligos: You can use software, such as “Oligo Cuts” (L. Harden, Davidson College, http://gcat.davidson.edu/IGEM06/oligo.html), to determine the optimal length and number of oligos for building your BioBrick. An example of a final assembly is shown below:

[ Oligo A ][  other  ][ other ][ Oligo B ]
||||||||||||||||||||||||||||||||||||||||||
[    Oligo D    ][  other  ][  Oligo C   ]

Add the following modifications to the oligos that were generated by the program:

5’ sense oligo (A):	5’ CTAGA [oligo sequence] 3’
3’ sense oligo (B):	5’ [oligo sequence] ACTAGTAGCGGCCGCTGCA 3’
5’ anti-sense oligo (C):	5’ GCGGCCGCTACTAGT [oligo sequence] 3’
3’ anti-sense oligo (D):	5’ [oligo sequence] T 3’

The final insert will have a XbaI sticky end upstream of the part, SpeI and NotI sites downstream, and a PstI sticky end downstream.

2. Have the oligos synthesized (you can order through a company like www.idtdna.com). Note: To avoid self-ligation of the oligo insert during the final ligation, do not add 5’ phosphates to the oligos. DNA nicks in the insert-vector ligation will be repaired via plasmid replication in E. coli.

3. Set up an annealing reaction as follows:

Oligo (100 μM)	3.0 μl of each
10x annealing buffer*	2.0 μl
dH2O	____ μl
	20 μl

Heat at 100°C for 5 min., remove the entire heat block or water bath from the heat source, and allow to cool slowly to room temperature.
--> *10x annealing buffer: 1 M NaCl; 100 mM Tris-HCl, pH 7.4

4. Use this formula to estimate ng/μl of the oligo insert:
[(total ng stock oligo 1 / μl dH2O used to dissolve dry oligo 1 + total ng stock oligo 2 / μl dH2O used to dissolve dry oligo 2 + …n) * 3 μl] / 20 μl

5. Ligate the double-stranded insert into a linearized vector with XbaI and PstI ends and transform into E. coli. (use any standard ligation/ transformation protocol)

PCR Amplification

1. Design your primers: For typical BioBrick construction, you want a PCR product that has an XbaI site upstream of your part, and SpeI, NotI, and PstI sites downstream of your part (with extra bases at each end to aid restriction digestion).

Forward primer:	5' CCTTTCTAGA [15-20 bp of the coding strand] 3'
Reverse primer:	5' AAGGCTGCAGCGGCCGCTACTAGT [15-20 bp reverse complement] 3'

Here is what your final double stranded product will look like:

5' [cctt tctaga f-primer >][Coding sequence][actagt a gcggccgctgca gcctt] 3'
|||| |||||| |||||||||||||||||||||||||||| |||||| | |||||||||||| |||||
3' [ggaa agatct][Rev. Comp. Seq.][< r-primer tgatca t cgccggcgacgt cggaa] 5'

2. Have the primers (oligos) synthesized (you can order through a company like www.idtdna.com). Note: A typical PCR reaction contains DNA template, forward and reverse primers, deoxynucleotide triphosphates (dNTP’s), Taq (Thermus aquaticus) polymerase, MgCl₂, and a reaction buffer.

3. The following is a PCR reaction that uses Promega GoTaq Green master mix (contains dNTP’s, Taq, MgCl2, and buffer).
DNA template 0.4 μl Forward primer (10 μM) 1.0 μl Reverse primer (10 μM) 1.0 μl 2x GoTaq master mix 25 μl dH2O 22.6 μl 50 μl PCR reaction:

• 95°C/ 3 min.
• (95°C/ 30 sec; 55°C*/ 30 sec; 72°C/ ___ sec**) x30 cycles
• 72°C/ 3 min.
• 4°C/ ∞

--> *This is the annealing temperature, which needs to be adjusted depending upon the Tm of the oligos
--> **For products 1 kb or less, 30 seconds is sufficient. For products larger than 1 kb, use 60 sec. per kb

4. Check 2 μl of the reaction via DNA gel electrophoresis.

5. Clean the remainder of the PCR-amplified DNA using the Zymo clean and concentrator kit (or QIAGEN PCR clean-up).

6. Digest the DNA with XbaI/ PstI, gel purify (or “QIAGEN PCR-clean”) the product, and use it as an insert it into a XbaI/ PstI linearized vector (e.g., V0120).