Haynes Lab:Notebook/David Barclay Undergrad Training/Plasmid Transformation/2013/10/27: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Line 76: | Line 76: | ||
| PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa | | PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa | ||
|- | |- | ||
| MAFA | | MAFA || treated cells || MAFA | ||
|- | |- | ||
| | | GLP1R || treated cells || GLP1R | ||
|- | |- | ||
| | | PCSK1 || treated cells || PCSK1 | ||
|- | |- | ||
| | | IAPP || treated cells || IAPP | ||
|- | |- | ||
| | | KCNQ2 || treated cells || KCNQ2 | ||
|- | |- | ||
| | | GAPD || treated cells || GAPD (reference gene) | ||
|} | |} | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> |
Revision as of 10:30, 4 November 2013
Haynes BioBrick Cloning | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UPLassay
Reaction List
|