Haynes Lab:Notebook/David Barclay Undergrad Training/Plasmid Transformation/2013/10/27: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
(12 intermediate revisions by the same user not shown)
Line 24: Line 24:
| Rxn 4: || treated cells || PCSK1
| Rxn 4: || treated cells || PCSK1
|-
|-
| Rxn 5: || treated cells || GAPD (reference gene)
| Rxn 5: || treated cells || IAPP
|-
|-
| Rxn 6: || untreated cells || PDX1
| Rxn 6: || treated cells || KCNQ2
|-
|-
| Rxn 7: || untreated cells || MAFA
| Rxn 7: || treated cells || GAPD (reference gene)
|-
|-
| Rxn 8: || untreated cells || GLP1R
| Rxn 8: || untreated cells || PDX1
|-
|-
| Rxn 9: || untreated cells || PCSK1
| Rxn 9: || untreated cells || MAFA
|-
|-
| Rxn 10: || untreated cells || GAPD (reference gene)
| Rxn 10: || untreated cells || GLP1R
|-
|-
| Rxn 11: || no template || PDX1
| Rxn 11: || untreated cells || PCSK1
|-
|-
| Rxn 12: || no template || MAFA
| Rxn 12: || untreated cells || IAPP
|-
|-
| Rxn 13: || no template || GLP1R
| Rxn 13: || untreated cells || KCNQ2
|-
|-
| Rxn 14: || no template || PCSK1
| Rxn 14: || untreated cells || GAPD (reference gene)
|-
|-
| Rxn 15: || no template || GAPD (reference gene)
| Rxn 15: || no template || PDX1
|-
| Rxn 16: || no template || MAFA
|-
| Rxn 17: || no template || GLP1R
|-
| Rxn 18: || no template || PCSK1
|-
| Rxn 19: || no template || IAPP
|-
| Rxn 20: || no template || KCN2Q
|-
| Rxn 21: || no template || GAPD (reference gene)
|}
|}


Line 53: Line 65:
*Using as Reference, discount gene names on left side
*Using as Reference, discount gene names on left side


 
==Primers==
*Created from Roche Applied Science https://www.roche-applied-science.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1#tab-3
{| class="wikitable" style="width: 800px;"
|- valign="top"
| '''PRIMERS LIST'''
{| width= 700px
|-
|   || '''Roche Name''' || '''Left Primer''' || '''Right Primer''' || '''UPL probe'''
|-
| PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa || #78, cat.no. 04689011001
|-
| MAFA || NM_201589.3 || agcgagaagtgccaactcc || ttgtacaggtcccgctcttt || #39, cat.no. 04687973001
|-
| GLP1R || NM_002062.3 || gtggcggccaattactactg || ggccagcagtgtgtacagg || #22, cat.no. 04686969001
|-
| PCSK1 || NM_000439.4 || caagagcttgtgaaggacaaga || tctttcagccaagagcacag ||  #1, cat.no. 04684974001
|-
| IAPP || NM_000415.2 || ttaccaaattgtagaggctttcg || ccctgcctctatacactcactacc  ||  #77, cat.no. 04689003001
|-
| KCNQ2(4) || NM_172108.3 || gacgtcatcgagcagtactca || cccacgatctggtccact || #56, cat.no. 04688538001
|-
| GAPD (Ref) || NM_002046.3 || agccacatcgctcagacac || gcccaatacgaccaaatcc || #60, cat.no. 04688589001
|}
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}


__NOTOC__
__NOTOC__

Revision as of 00:13, 15 November 2013

Haynes BioBrick Cloning <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

UPLassay

  • This is a test run for RT-PCR training. Using gene targets identified in prior research to pancreas differentiation gene sequences.

Reaction List

REACTION LIST
  Template cDNA Gene Target
Rxn 1: treated cells PDX1
Rxn 2: treated cells MAFA
Rxn 3: treated cells GLP1R
Rxn 4: treated cells PCSK1
Rxn 5: treated cells IAPP
Rxn 6: treated cells KCNQ2
Rxn 7: treated cells GAPD (reference gene)
Rxn 8: untreated cells PDX1
Rxn 9: untreated cells MAFA
Rxn 10: untreated cells GLP1R
Rxn 11: untreated cells PCSK1
Rxn 12: untreated cells IAPP
Rxn 13: untreated cells KCNQ2
Rxn 14: untreated cells GAPD (reference gene)
Rxn 15: no template PDX1
Rxn 16: no template MAFA
Rxn 17: no template GLP1R
Rxn 18: no template PCSK1
Rxn 19: no template IAPP
Rxn 20: no template KCN2Q
Rxn 21: no template GAPD (reference gene)
  • Run 3 Each
  • 45 Reactions Run
  • Using Variation 2

Variation 2
Figure 1

  • Using as Reference, discount gene names on left side

Primers

PRIMERS LIST
  Roche Name Left Primer Right Primer UPL probe
PDX1 NM_000209.3 aagctcacgcgtggaaag gccgtgagatgtacttgttgaa #78, cat.no. 04689011001
MAFA NM_201589.3 agcgagaagtgccaactcc ttgtacaggtcccgctcttt #39, cat.no. 04687973001
GLP1R NM_002062.3 gtggcggccaattactactg ggccagcagtgtgtacagg #22, cat.no. 04686969001
PCSK1 NM_000439.4 caagagcttgtgaaggacaaga tctttcagccaagagcacag #1, cat.no. 04684974001
IAPP NM_000415.2 ttaccaaattgtagaggctttcg ccctgcctctatacactcactacc #77, cat.no. 04689003001
KCNQ2(4) NM_172108.3 gacgtcatcgagcagtactca cccacgatctggtccact #56, cat.no. 04688538001
GAPD (Ref) NM_002046.3 agccacatcgctcagacac gcccaatacgaccaaatcc #60, cat.no. 04688589001


Retrieved from "https://openwetware.org/mediawiki/index.php?title=Haynes_Lab:Notebook/David_Barclay_Undergrad_Training/Plasmid_Transformation/2013/10/27&oldid=757287"