Haynes Lab:Notebook/David Barclay Undergrad Training/Plasmid Transformation/2013/10/27: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
|||
(6 intermediate revisions by the same user not shown) | |||
Line 69: | Line 69: | ||
{| class="wikitable" style="width: 800px;" | {| class="wikitable" style="width: 800px;" | ||
|- valign="top" | |- valign="top" | ||
| '''PRIMERS | | '''PRIMERS LIST''' | ||
{| width= | {| width= 700px | ||
|- | |- | ||
| || '''Roche Name''' || '''Left Primer''' || '''Right Primer''' | | || '''Roche Name''' || '''Left Primer''' || '''Right Primer''' || '''UPL probe''' | ||
|- | |- | ||
| PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa | | PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa || #78, cat.no. 04689011001 | ||
|- | |- | ||
| MAFA || | | MAFA || NM_201589.3 || agcgagaagtgccaactcc || ttgtacaggtcccgctcttt || #39, cat.no. 04687973001 | ||
|- | |- | ||
| GLP1R || | | GLP1R || NM_002062.3 || gtggcggccaattactactg || ggccagcagtgtgtacagg || #22, cat.no. 04686969001 | ||
|- | |||
| PCSK1 || NM_000439.4 || caagagcttgtgaaggacaaga || tctttcagccaagagcacag || #1, cat.no. 04684974001 | |||
|- | |- | ||
| | | IAPP || NM_000415.2 || ttaccaaattgtagaggctttcg || ccctgcctctatacactcactacc || #77, cat.no. 04689003001 | ||
|- | |- | ||
| | | KCNQ2(4) || NM_172108.3 || gacgtcatcgagcagtactca || cccacgatctggtccact || #56, cat.no. 04688538001 | ||
|- | |- | ||
| | | GAPD (Ref) || NM_002046.3 || agccacatcgctcagacac || gcccaatacgaccaaatcc || #60, cat.no. 04688589001 | ||
| | |||
| | |||
|} | |} | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> |
Revision as of 00:13, 15 November 2013
Haynes BioBrick Cloning | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UPLassay
Reaction List
|