Haynes Lab:Notebook/David Barclay Undergrad Training/Plasmid Transformation/2013/10/27: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 65: Line 65:
*Using as Reference, discount gene names on left side
*Using as Reference, discount gene names on left side


 
==Primers==
*Created from Roche Applied Science https://www.roche-applied-science.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1#tab-3
| '''PRIMERS LISt'''
{| width=300px
|-
|   || '''Roche Name''' || '''Left Primer''' || '''Right Primer'''
|-
| PDX1 || Homo sapiens pancreatic and duodenal homeobox 1 (PDX1), mRNA NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa
|-
| Primer 2: || treated cells || MAFA
|-
| Rxn 3: || treated cells || GLP1R
|-
| Rxn 4: || treated cells || PCSK1
|-
| Rxn 5: || treated cells || IAPP
|-
| Rxn 6: || treated cells || KCNQ2
|-
| Rxn 7: || treated cells || GAPD (reference gene)
|-
| Rxn 8: || untreated cells || PDX1
|-
| Rxn 9: || untreated cells || MAFA
|-
| Rxn 10: || untreated cells || GLP1R
|-
| Rxn 11: || untreated cells || PCSK1
|-
| Rxn 12: || untreated cells || IAPP
|-
| Rxn 13: || untreated cells || KCNQ2
|-
| Rxn 14: || untreated cells || GAPD (reference gene)
|-
| Rxn 15: || no template || PDX1
|-
| Rxn 16: || no template || MAFA
|-
| Rxn 17: || no template || GLP1R
|-
| Rxn 18: || no template || PCSK1
|-
| Rxn 19: || no template || IAPP
|-
| Rxn 20: || no template || KCN2Q
|-
| Rxn 21: || no template || GAPD (reference gene)
|}
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}


__NOTOC__
__NOTOC__

Revision as of 10:00, 4 November 2013

Haynes BioBrick Cloning <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

UPLassay

  • This is a test run for RT-PCR training. Using gene targets identified in prior research to pancreas differentiation gene sequences.

Reaction List

REACTION LIST
  Template cDNA Gene Target
Rxn 1: treated cells PDX1
Rxn 2: treated cells MAFA
Rxn 3: treated cells GLP1R
Rxn 4: treated cells PCSK1
Rxn 5: treated cells IAPP
Rxn 6: treated cells KCNQ2
Rxn 7: treated cells GAPD (reference gene)
Rxn 8: untreated cells PDX1
Rxn 9: untreated cells MAFA
Rxn 10: untreated cells GLP1R
Rxn 11: untreated cells PCSK1
Rxn 12: untreated cells IAPP
Rxn 13: untreated cells KCNQ2
Rxn 14: untreated cells GAPD (reference gene)
Rxn 15: no template PDX1
Rxn 16: no template MAFA
Rxn 17: no template GLP1R
Rxn 18: no template PCSK1
Rxn 19: no template IAPP
Rxn 20: no template KCN2Q
Rxn 21: no template GAPD (reference gene)
  • Run 3 Each
  • 45 Reactions Run
  • Using Variation 2

Variation 2
Figure 1

  • Using as Reference, discount gene names on left side

Primers

 PRIMERS LISt
  Roche Name Left Primer Right Primer
PDX1 Homo sapiens pancreatic and duodenal homeobox 1 (PDX1), mRNA NM_000209.3 aagctcacgcgtggaaag gccgtgagatgtacttgttgaa
Primer 2: treated cells MAFA
Rxn 3: treated cells GLP1R
Rxn 4: treated cells PCSK1
Rxn 5: treated cells IAPP
Rxn 6: treated cells KCNQ2
Rxn 7: treated cells GAPD (reference gene)
Rxn 8: untreated cells PDX1
Rxn 9: untreated cells MAFA
Rxn 10: untreated cells GLP1R
Rxn 11: untreated cells PCSK1
Rxn 12: untreated cells IAPP
Rxn 13: untreated cells KCNQ2
Rxn 14: untreated cells GAPD (reference gene)
Rxn 15: no template PDX1
Rxn 16: no template MAFA
Rxn 17: no template GLP1R
Rxn 18: no template PCSK1
Rxn 19: no template IAPP
Rxn 20: no template KCN2Q
Rxn 21: no template GAPD (reference gene)


Retrieved from "https://openwetware.org/mediawiki/index.php?title=Haynes_Lab:Notebook/David_Barclay_Undergrad_Training/Plasmid_Transformation/2013/10/27&oldid=753638"