Haynes Lab:Notebook/David Barclay Undergrad Training/Plasmid Transformation/2013/10/27: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 76: Line 76:
| PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa
| PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa
|-
|-
| MAFA: || treated cells || MAFA
| MAFA || treated cells || MAFA
|-
|-
| Rxn 3: || treated cells || GLP1R
| GLP1R || treated cells || GLP1R
|-
|-
| Rxn 4: || treated cells || PCSK1
| PCSK1 || treated cells || PCSK1
|-
|-
| Rxn 5: || treated cells || IAPP
| IAPP || treated cells || IAPP
|-
|-
| Rxn 6: || treated cells || KCNQ2
| KCNQ2 || treated cells || KCNQ2
|-
|-
| Rxn 7: || treated cells || GAPD (reference gene)
| GAPD || treated cells || GAPD (reference gene)
|-
| Rxn 8: || untreated cells || PDX1
|-
| Rxn 9: || untreated cells || MAFA
|-
| Rxn 10: || untreated cells || GLP1R
|-
| Rxn 11: || untreated cells || PCSK1
|-
| Rxn 12: || untreated cells || IAPP
|-
| Rxn 13: || untreated cells || KCNQ2
|-
| Rxn 14: || untreated cells || GAPD (reference gene)
|-
| Rxn 15: || no template || PDX1
|-
| Rxn 16: || no template || MAFA
|-
| Rxn 17: || no template || GLP1R
|-
| Rxn 18: || no template || PCSK1
|-
| Rxn 19: || no template || IAPP
|-
| Rxn 20: || no template || KCN2Q
|-
| Rxn 21: || no template || GAPD (reference gene)
|}
|}
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->

Revision as of 10:30, 4 November 2013

Haynes BioBrick Cloning <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

UPLassay

  • This is a test run for RT-PCR training. Using gene targets identified in prior research to pancreas differentiation gene sequences.

Reaction List

REACTION LIST
  Template cDNA Gene Target
Rxn 1: treated cells PDX1
Rxn 2: treated cells MAFA
Rxn 3: treated cells GLP1R
Rxn 4: treated cells PCSK1
Rxn 5: treated cells IAPP
Rxn 6: treated cells KCNQ2
Rxn 7: treated cells GAPD (reference gene)
Rxn 8: untreated cells PDX1
Rxn 9: untreated cells MAFA
Rxn 10: untreated cells GLP1R
Rxn 11: untreated cells PCSK1
Rxn 12: untreated cells IAPP
Rxn 13: untreated cells KCNQ2
Rxn 14: untreated cells GAPD (reference gene)
Rxn 15: no template PDX1
Rxn 16: no template MAFA
Rxn 17: no template GLP1R
Rxn 18: no template PCSK1
Rxn 19: no template IAPP
Rxn 20: no template KCN2Q
Rxn 21: no template GAPD (reference gene)
  • Run 3 Each
  • 45 Reactions Run
  • Using Variation 2

Variation 2
Figure 1

  • Using as Reference, discount gene names on left side

Primers

PRIMERS LISt
  Roche Name Left Primer Right Primer
PDX1 NM_000209.3 aagctcacgcgtggaaag gccgtgagatgtacttgttgaa
MAFA treated cells MAFA
GLP1R treated cells GLP1R
PCSK1 treated cells PCSK1
IAPP treated cells IAPP
KCNQ2 treated cells KCNQ2
GAPD treated cells GAPD (reference gene)


Retrieved from "https://openwetware.org/mediawiki/index.php?title=Haynes_Lab:Notebook/David_Barclay_Undergrad_Training/Plasmid_Transformation/2013/10/27&oldid=753643"