Haynes Lab:Notebook/David Barclay Undergrad Training/Plasmid Transformation/2013/10/27

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 78: Line 78:
| MAFA || treated cells || MAFA
| MAFA || treated cells || MAFA
| GLP1R || treated cells || GLP1R
| GLP1R || NM_002062.3 || cacttggagctaattaaggtttgc || ccgtccagtctttctgctgt
| PCSK1 || treated cells || PCSK1
| PCSK1 || treated cells || PCSK1

Revision as of 13:46, 4 November 2013

Haynes BioBrick Cloning Main project page
Previous entry      Next entry


  • This is a test run for RT-PCR training. Using gene targets identified in prior research to pancreas differentiation gene sequences.

Reaction List

  Template cDNA Gene Target
Rxn 1: treated cells PDX1
Rxn 2: treated cells MAFA
Rxn 3: treated cells GLP1R
Rxn 4: treated cells PCSK1
Rxn 5: treated cells IAPP
Rxn 6: treated cells KCNQ2
Rxn 7: treated cells GAPD (reference gene)
Rxn 8: untreated cells PDX1
Rxn 9: untreated cells MAFA
Rxn 10: untreated cells GLP1R
Rxn 11: untreated cells PCSK1
Rxn 12: untreated cells IAPP
Rxn 13: untreated cells KCNQ2
Rxn 14: untreated cells GAPD (reference gene)
Rxn 15: no template PDX1
Rxn 16: no template MAFA
Rxn 17: no template GLP1R
Rxn 18: no template PCSK1
Rxn 19: no template IAPP
Rxn 20: no template KCN2Q
Rxn 21: no template GAPD (reference gene)
  • Run 3 Each
  • 45 Reactions Run
  • Using Variation 2

Variation 2
Figure 1

  • Using as Reference, discount gene names on left side


  Roche Name Left Primer Right Primer
PDX1 NM_000209.3 aagctcacgcgtggaaag gccgtgagatgtacttgttgaa
MAFA treated cells MAFA
GLP1R NM_002062.3 cacttggagctaattaaggtttgc ccgtccagtctttctgctgt
PCSK1 treated cells PCSK1
IAPP treated cells IAPP
KCNQ2 treated cells KCNQ2
GAPD treated cells GAPD (reference gene)

Personal tools