Haynes Lab:Notebook/David Barclay Undergrad Training/Plasmid Transformation/2013/10/27

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 82: Line 82:
| PCSK1 || NM_013628.2 || tggagttgcatataattccaaagtt || agcctcaatggcatcagttac ||  #42, cat.no. 04688015001
| PCSK1 || NM_013628.2 || tggagttgcatataattccaaagtt || agcctcaatggcatcagttac ||  #42, cat.no. 04688015001
| IAPP || NM_010491.2 || IAPP || aatgatgtgcatctccaaactg || tggttcagtgccacagagag  ||  #101, cat.no. 04692195001
| IAPP || NM_010491.2 || aatgatgtgcatctccaaactg || tggttcagtgccacagagag  ||  #101, cat.no. 04692195001
| KCNQ2 || NM_010611.2 || KCNQ2 || cacgcctacgtgttcctttta || cccctcagagctcttctcg || #2, cat.no. 04684982001
| KCNQ2 || NM_010611.2 || cacgcctacgtgttcctttta || cccctcagagctcttctcg || #2, cat.no. 04684982001
| GAPD || NM_008084.2 || GAPD (reference gene) || agcttgtcatcaacgggaag || tttgatgttagtggggtctcg || #9, cat.no. 04685075001
| GAPD (Ref) || NM_008084.2 || agcttgtcatcaacgggaag || tttgatgttagtggggtctcg || #9, cat.no. 04685075001
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->

Revision as of 06:01, 7 November 2013

Haynes BioBrick Cloning Main project page
Previous entry      Next entry


  • This is a test run for RT-PCR training. Using gene targets identified in prior research to pancreas differentiation gene sequences.

Reaction List

  Template cDNA Gene Target
Rxn 1: treated cells PDX1
Rxn 2: treated cells MAFA
Rxn 3: treated cells GLP1R
Rxn 4: treated cells PCSK1
Rxn 5: treated cells IAPP
Rxn 6: treated cells KCNQ2
Rxn 7: treated cells GAPD (reference gene)
Rxn 8: untreated cells PDX1
Rxn 9: untreated cells MAFA
Rxn 10: untreated cells GLP1R
Rxn 11: untreated cells PCSK1
Rxn 12: untreated cells IAPP
Rxn 13: untreated cells KCNQ2
Rxn 14: untreated cells GAPD (reference gene)
Rxn 15: no template PDX1
Rxn 16: no template MAFA
Rxn 17: no template GLP1R
Rxn 18: no template PCSK1
Rxn 19: no template IAPP
Rxn 20: no template KCN2Q
Rxn 21: no template GAPD (reference gene)
  • Run 3 Each
  • 45 Reactions Run
  • Using Variation 2

Variation 2
Figure 1

  • Using as Reference, discount gene names on left side


  Roche Name Left Primer Right Primer UPL probe
PDX1 NM_000209.3 gaaatccaccaaagctcacg cgggttccgctgtgtaag #51, cat.no. 04688481001
MAFA AB086961.1 ctccagagccaggtggag gtacaggtcccgctccttg #10, cat.no. 04685091001
GLP1R NM_021332.2 gatgggctcctctcctatca agatacacgccttccaccag #15, cat.no. 04685148001
PCSK1 NM_013628.2 tggagttgcatataattccaaagtt agcctcaatggcatcagttac #42, cat.no. 04688015001
IAPP NM_010491.2 aatgatgtgcatctccaaactg tggttcagtgccacagagag #101, cat.no. 04692195001
KCNQ2 NM_010611.2 cacgcctacgtgttcctttta cccctcagagctcttctcg #2, cat.no. 04684982001
GAPD (Ref) NM_008084.2 agcttgtcatcaacgggaag tttgatgttagtggggtctcg #9, cat.no. 04685075001

Personal tools