Haynes Lab:Notebook/Investigating Photo-Switchable Synthetic Nucleosomes/2012/11/26
From OpenWetWare
(Autocreate 2012/11/26 Entry for Haynes_Lab:Notebook/Investigating_Photo-Switchable_Synthetic_Nucleosomes) |
Current revision (20:41, 8 December 2012) (view source) (→November 26, 2012) |
||
| (3 intermediate revisions not shown.) | |||
| Line 6: | Line 6: | ||
| colspan="2"| | | colspan="2"| | ||
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | ||
| - | == | + | ==November 26, 2012== |
| - | * | + | '''Gibson assembly written by Dr. Haynes''' |
| + | *All 8 primers were ordered | ||
| + | |||
| + | The Gibson assembly method joins double stranded fragments that have overlapping matching ends. Matching ends (instead of BioBrick cut sites) are artificially added via PCR. To do Gibson assembly, we need primers that span 40 bp across junctions of the individual parts. | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | We will cut the vector with XbaI and SpeI so the ends will look like this: | ||
| + | |||
| + | pSB1A3 left end: …tctggaattcgcggccgctt/ | ||
| + | |||
| + | pSB1A3 right end: /ctagtagcggccgctgcagt… | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | We want to join the following, and add a "6-histidine" tag (and stop codon) for antibody staining: | ||
| + | |||
| + | 1. pSB1A3 left end / H2B / LOV +His tag/ pSB1A3 right end | ||
| + | |||
| + | …to get a circular plasmid. | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | Let's also try swapping LOV and H2B (like you suggested before) just to see what happens | ||
| + | |||
| + | 2. pSB1A3 left end / LOV / H2B +His tag/ pSB1A3 right end | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | Each part gets a 40 bp forward and reverse primer. A dash indicates the junction between the parts: | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | *For assembly 1, amplify H2B with | ||
| + | # "1A3/H2B fwd", 5'- tctggaattcgcggccgcttCTAGA-ATGCCAGAGCCAGCGAAGTC | ||
| + | # "H2B/LOV rev", 5'-CGTTCAAGTGTAGTAGCCAA-CTTAGCGCTGGTGTACTTGG | ||
| + | |||
| + | *…and amplify LOV with | ||
| + | # "H2B/LOV fwd", 5'-CCAAGTACACCAGCGCTAAG-TTGGCTACTACACTTGAACG | ||
| + | # "LOV+his/1A3 rev", 5'- actgcagcggccgctactagT-ttagtggtgatggtgatgatg-AAGTTCTTTTGCCGCCTCAT | ||
| + | |||
| + | After PCR of each part, the two PCR products will be mixed with the X/S cut vector and subjected to isothermal assembly: http://openwetware.org/wiki/Haynes:Gibson_Assembly | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | * For assembly 2, amplify LOV with | ||
| + | # "1A3/LOV fwd", 5'-tctggaattcgcggccgcttCTAGA-TTGGCTACTACACTTGAACG | ||
| + | # "LOV/H2B rev", 5'-GACTTCGCTGGCTCTGGCAT-AAGTTCTTTTGCCGCCTCAT | ||
| + | |||
| + | * …and amplify H2B with | ||
| + | # "LOV/H2B fwd", 5'-ATGAGGCGGCAAAAGAACTT-ATGCCAGAGCCAGCGAAGTC | ||
| + | # "H2B+his/1A3 rev", 5'-actgcagcggccgctactagT-ttagtggtgatggtgatgatg-CTTAGCGCTGGTGTACTTGG | ||
| + | |||
| + | |||
Current revision
Main project page Previous entry Next entry
| |
November 26, 2012Gibson assembly written by Dr. Haynes
The Gibson assembly method joins double stranded fragments that have overlapping matching ends. Matching ends (instead of BioBrick cut sites) are artificially added via PCR. To do Gibson assembly, we need primers that span 40 bp across junctions of the individual parts.
We will cut the vector with XbaI and SpeI so the ends will look like this: pSB1A3 left end: …tctggaattcgcggccgctt/ pSB1A3 right end: /ctagtagcggccgctgcagt…
1. pSB1A3 left end / H2B / LOV +His tag/ pSB1A3 right end …to get a circular plasmid.
2. pSB1A3 left end / LOV / H2B +His tag/ pSB1A3 right end
After PCR of each part, the two PCR products will be mixed with the X/S cut vector and subjected to isothermal assembly: http://openwetware.org/wiki/Haynes:Gibson_Assembly
| |



