Haynes Lab:Notebook/Investigating Photo-Switchable Synthetic Nucleosomes/2012/11/26: Difference between revisions
(fix raw html notebook nav) |
|||
(One intermediate revision by one other user not shown) | |||
Line 2: | Line 2: | ||
|- | |- | ||
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span> | |style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span> | ||
|style="background-color: #F2F2F2" align="center"| | |style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]] }}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}} | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
Line 46: | Line 46: | ||
For assembly 1, amplify H2B with | *For assembly 1, amplify H2B with | ||
# "1A3/H2B fwd", 5'- tctggaattcgcggccgcttCTAGA-ATGCCAGAGCCAGCGAAGTC | |||
# "H2B/LOV rev", 5'-CGTTCAAGTGTAGTAGCCAA-CTTAGCGCTGGTGTACTTGG | |||
…and amplify LOV with | *…and amplify LOV with | ||
# "H2B/LOV fwd", 5'-CCAAGTACACCAGCGCTAAG-TTGGCTACTACACTTGAACG | |||
# "LOV+his/1A3 rev", 5'- actgcagcggccgctactagT-ttagtggtgatggtgatgatg-AAGTTCTTTTGCCGCCTCAT | |||
After PCR of each part, the two PCR products will be mixed with the X/S cut vector and subjected to isothermal assembly: http://openwetware.org/wiki/Haynes:Gibson_Assembly | After PCR of each part, the two PCR products will be mixed with the X/S cut vector and subjected to isothermal assembly: http://openwetware.org/wiki/Haynes:Gibson_Assembly | ||
Line 59: | Line 59: | ||
For assembly 2, amplify LOV with | * For assembly 2, amplify LOV with | ||
# "1A3/LOV fwd", 5'-tctggaattcgcggccgcttCTAGA-TTGGCTACTACACTTGAACG | |||
# "LOV/H2B rev", 5'-GACTTCGCTGGCTCTGGCAT-AAGTTCTTTTGCCGCCTCAT | |||
…and amplify H2B with | * …and amplify H2B with | ||
# "LOV/H2B fwd", 5'-ATGAGGCGGCAAAAGAACTT-ATGCCAGAGCCAGCGAAGTC | |||
# "H2B+his/1A3 rev", 5'-actgcagcggccgctactagT-ttagtggtgatggtgatgatg-CTTAGCGCTGGTGTACTTGG | |||
Latest revision as of 22:19, 26 September 2017
Project name | Main project page Previous entry Next entry |
November 26, 2012Gibson assembly written by Dr. Haynes
The Gibson assembly method joins double stranded fragments that have overlapping matching ends. Matching ends (instead of BioBrick cut sites) are artificially added via PCR. To do Gibson assembly, we need primers that span 40 bp across junctions of the individual parts.
We will cut the vector with XbaI and SpeI so the ends will look like this: pSB1A3 left end: …tctggaattcgcggccgctt/ pSB1A3 right end: /ctagtagcggccgctgcagt…
1. pSB1A3 left end / H2B / LOV +His tag/ pSB1A3 right end …to get a circular plasmid.
2. pSB1A3 left end / LOV / H2B +His tag/ pSB1A3 right end
After PCR of each part, the two PCR products will be mixed with the X/S cut vector and subjected to isothermal assembly: http://openwetware.org/wiki/Haynes:Gibson_Assembly
|