Haynes Lab:Notebook/Investigating Photo-Switchable Synthetic Nucleosomes/2012/11/26

From OpenWetWare

< Haynes Lab:Notebook | Investigating Photo-Switchable Synthetic Nucleosomes | 2012 | 11
Revision as of 19:41, 8 December 2012 by Vi Nguyen (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

November 26, 2012

Gibson assembly written by Dr. Haynes

  • All 8 primers were ordered

The Gibson assembly method joins double stranded fragments that have overlapping matching ends. Matching ends (instead of BioBrick cut sites) are artificially added via PCR. To do Gibson assembly, we need primers that span 40 bp across junctions of the individual parts.



We will cut the vector with XbaI and SpeI so the ends will look like this:

pSB1A3 left end: …tctggaattcgcggccgctt/

pSB1A3 right end: /ctagtagcggccgctgcagt…



We want to join the following, and add a "6-histidine" tag (and stop codon) for antibody staining:

1. pSB1A3 left end / H2B / LOV +His tag/ pSB1A3 right end

…to get a circular plasmid.



Let's also try swapping LOV and H2B (like you suggested before) just to see what happens

2. pSB1A3 left end / LOV / H2B +His tag/ pSB1A3 right end



Each part gets a 40 bp forward and reverse primer. A dash indicates the junction between the parts:



  • For assembly 1, amplify H2B with
  1. "1A3/H2B fwd", 5'- tctggaattcgcggccgcttCTAGA-ATGCCAGAGCCAGCGAAGTC
  2. "H2B/LOV rev", 5'-CGTTCAAGTGTAGTAGCCAA-CTTAGCGCTGGTGTACTTGG
  • …and amplify LOV with
  1. "H2B/LOV fwd", 5'-CCAAGTACACCAGCGCTAAG-TTGGCTACTACACTTGAACG
  2. "LOV+his/1A3 rev", 5'- actgcagcggccgctactagT-ttagtggtgatggtgatgatg-AAGTTCTTTTGCCGCCTCAT

After PCR of each part, the two PCR products will be mixed with the X/S cut vector and subjected to isothermal assembly: http://openwetware.org/wiki/Haynes:Gibson_Assembly



  • For assembly 2, amplify LOV with
  1. "1A3/LOV fwd", 5'-tctggaattcgcggccgcttCTAGA-TTGGCTACTACACTTGAACG
  2. "LOV/H2B rev", 5'-GACTTCGCTGGCTCTGGCAT-AAGTTCTTTTGCCGCCTCAT
  • …and amplify H2B with
  1. "LOV/H2B fwd", 5'-ATGAGGCGGCAAAAGAACTT-ATGCCAGAGCCAGCGAAGTC
  2. "H2B+his/1A3 rev", 5'-actgcagcggccgctactagT-ttagtggtgatggtgatgatg-CTTAGCGCTGGTGTACTTGG




Personal tools