*[[User:Steven J. Koch|Steve Koch]] 00:17, 12 April 2008 (EDT):I tried this using the [[:Template:Project Base]] and [[:Template:Entry Base]] pages I created and it seemed to work. My opinion is that it's easier to explain how to setup things. (Because you can just say, cut and paste the following:<pre><nowiki>{{subst:Project Page}}</nowiki></pre>
*[[User:Steven J. Koch|Steve Koch]] 00:17, 12 April 2008 (EDT):I tried this using the [[:Template:Project Base]] and [[:Template:Entry Base]] pages I created and it seemed to work. My opinion is that it's easier to explain how to setup things. (Because you can just say, cut and paste the following:<pre><nowiki>{{subst:Project Page}}</nowiki></pre>
*[[User:Ricardo Vidal|Ricardo Vidal]] 00:20, 14 April 2008 (EDT): This would make it much easier but there is the matter of keeping things open to editing of the templates and such. If we use "universal" templates, any changes a user makes would change all the notebooks. Also, individual templates per user beats the purpose.<br><br/>We are almost about to roll out our "one-click" autocreate notebook that will make this all so much simpler :)
**[[User:Steven J. Koch|Steve Koch]] 01:09, 14 April 2008 (EDT):Yeah, one-click will be great. Just a detail, though: when you use "subst:" in the template (as above), it loads the entire text of the template upon saving (as opposed to each time page is loaded)--and so the editing the template will not change all the notebooks previously created.
***[[User:Ricardo Vidal|Ricardo Vidal]] 01:12, 14 April 2008 (EDT): Oh, I'm sorry. I didn't notice the "subst:" in there. My bad. That sounds like a great idea. I'll look into that tomorrow and maybe we can get some new easier tutorials ready :). Thanks for the great feedback!
==Addition of example and screencast help a lot!==
==Addition of example and screencast help a lot!==
[[User:Steven J. Koch|Steve Koch]] 23:51, 11 April 2008 (EDT):Jason and Ricardo -- the addition of the link to example notebook along with the screencast are a big help. I was able to set up my notebook, and while doing so, everything "clicked" and made sense finally. Thanks!
[[User:Steven J. Koch|Steve Koch]] 23:51, 11 April 2008 (EDT):Jason and Ricardo -- the addition of the link to example notebook along with the screencast are a big help. I was able to set up my notebook, and while doing so, everything "clicked" and made sense finally. Thanks!
*'''[[User:Jason R. Kelly|Jason R. Kelly]] 00:44, 12 April 2008 (EDT)''': Cool, thanks for the great comments above.
==Setting up your Lab Notebook (Manually)==
* To set up your lab notebook you'll first need to create a few pages, cut and paste some starting wiki code and put them in the right places. As soon as they are set up, you'll be a click away from creating new lab notebook entries.
* The required pages are:
'''1. The Notebook page''' You should create the page as <code><nowiki>[[User:Your UserName/Notebook]]</nowiki></code>. This page does not require a template. On your new lab notebook page, add a link to a new page by adding the wiki code, <code><nowiki>[[/Test Project]]</nowiki></code>
'''2. The Project page''' This is the "Test Project" page you created a link to on your main notebook page. Cut and paste the short wiki code from one of the following boxes:
'''3. The Entry Base page''' Click on the "customize your entry pages" link to create the "entry base page". On this new page, cut and paste the short wiki code from one of the following boxes:
*By putting these pages in their proper places you will not only keep [[OpenWetWare:Tidy|OWW tidy]], but you'll also be able to take full advantage of the features we've built into the lab notebook.
* By simply copying and pasting the wiki code from the boxes, you'll have your lab notebook working in no time. It's as simple as 1, 2, 3!
| align="center"| Copy template wiki code || align="center"| [[image:arrow_right.png]] || align="center"| Create page || align="center"| [[image:arrow_right.png]] || align="center"| Paste wiki code & Save
|}
:{| {{table}} width="410px"
|-
|style="background-color:#e5edc8;" align="center" | [[image:important-orange.png|left]]How to set up your OWW lab notebook<br />'''[[/Screencast|View screencast]]'''
|}</center>
'''3/5/15 Bacteria 16S Sequence'''
'''Purpose''': This lab used genetic sequences found in Transect Three to identify exactly what species of bacteria inhabit the area.
'''
Materials & Methods''': During the Microbiology Lab we performed a Polymerase Chain Reaction on bacteria from our Hay Infusion Culture. We selected one sample from a nutrient agar plate and one sample from a tetracycline plate to perform the PCR on. We transferred a single bacterial colony from each plate to a 100 microliters of distilled later in a sterile tube. We incubated the tubes for 10 minutes at 100 degrees Celsius and then centrifuged them for 5 minutes at 13,400 rpm. We added 20 microliters of primer to a PCR tube which contained a PCR bead, and then transferred 5 microliters of supernatant from our centrifuged samples to the PCR tube and placed it in the PCR machine. The PCR amplified the 16S gene, we received a sequence from this, which we entered into BLAST. BLAST identified which type of bacteria the sample came from using the full 16S rRNA sequence we were given.
'''Results''': Our Samples were labelled 13A and 13D. 13A was identified as Chryseobacteria and 13D was identified as Variovorax. Sample 13A was dubbed MB65 and had 134 nucleotides. Sample 13D was dubbed MB66 and had 135 nucleotides. Their raw sequences are given below.
Conclusion''': Some of our findings were contrary to information uncovered upon research of the actual bacteria identified. For example, Sample 13A came from a tetracycline plate and was identified by BLAST as Variovorax. Our observations said that the bacteria was not motile, rod shaped, gram positive, and most likely a strepto bacilli. However research proved that Variovorax is a rod shaped gram negative bacteria. Our method of determining if a bacteria was gram negative or positive was by observing the color of the bacteria on a wet mount in a compound microscope. Some of our wet mounts had both pink and purple on them, so we could have interpreted the results incorrectly. However, it was hard to find an in-depth explanation of the appearance of Variovorax. Our other sample, Sample 13D was identified as Chryseobacteria. We observed this sample as yellow, round, smooth, concentrated, flat, vibrating, and gram negative. Chryseobacteria are yellow, round and gram negative, which matches what we found when examining the bacteria with a compound microscope. Our two bacterial samples have similar characteristics. They are both bacilli and gram negative. Gram negative means that they did not retain the crystal violet dye used in the procedure because they have less peptidoglycan in their cell walls. Variovorax inhabits soil, as does Chryseobacteria. Both bacterias can survive extreme temperatures, which means that this snow day should be a piece of cake for them.
References
Han, J.-I., Choi, H.-K., & Lee, S.-W. (2011). Complete Genome Sequence of the Metabolically
Versatile Plant Growth-Promoting Endophyte Variovorax paradoxus S110. Journal of Bacteriology,
Steve Koch 00:05, 12 April 2008 (EDT):I am not sure whether this would be good to change the help page, but below are my suggested tweaks that would have helped my understanding (for lack of a better method, I'll color my changes red):
To set up your lab notebook you'll first need to create a few pages, cut and paste some starting wiki code and put them in the right places. As soon as they are set up, you'll be a click away from creating new lab notebook entries.
The required pages are:
The Notebook page (You should create the page as [[User:Your UserName/Notebook]]. This page does not require a template. On your new lab notebook page, add a link to a new page by add the wiki code, [[/Test Project]])
The Project page (This is the "Test Project" page you created a link to on your main notebook page. Cut and paste all of the wiki code from one of the following templates ((NOTE: Here is where I think it would be simpler to have them add a substitution template instead)Standard or iGEM template)
The Entry Base page (Click on the "customize your entry pages" link to create the "entry base page". On this new page, cut and paste all of the wiki code from one of the following templates Standard or iGEM template)
Is it simpler to have users use a substitution template instead of "edit"+"cut and paste?"
Steve Koch 00:17, 12 April 2008 (EDT):I tried this using the Template:Project Base and Template:Entry Base pages I created and it seemed to work. My opinion is that it's easier to explain how to setup things. (Because you can just say, cut and paste the following:
{{subst:Project Page}}
Ricardo Vidal 00:20, 14 April 2008 (EDT): This would make it much easier but there is the matter of keeping things open to editing of the templates and such. If we use "universal" templates, any changes a user makes would change all the notebooks. Also, individual templates per user beats the purpose.
We are almost about to roll out our "one-click" autocreate notebook that will make this all so much simpler :)
Steve Koch 01:09, 14 April 2008 (EDT):Yeah, one-click will be great. Just a detail, though: when you use "subst:" in the template (as above), it loads the entire text of the template upon saving (as opposed to each time page is loaded)--and so the editing the template will not change all the notebooks previously created.
Ricardo Vidal 01:12, 14 April 2008 (EDT): Oh, I'm sorry. I didn't notice the "subst:" in there. My bad. That sounds like a great idea. I'll look into that tomorrow and maybe we can get some new easier tutorials ready :). Thanks for the great feedback!
Addition of example and screencast help a lot!
Steve Koch 23:51, 11 April 2008 (EDT):Jason and Ricardo -- the addition of the link to example notebook along with the screencast are a big help. I was able to set up my notebook, and while doing so, everything "clicked" and made sense finally. Thanks!
Jason R. Kelly 00:44, 12 April 2008 (EDT): Cool, thanks for the great comments above.
Setting up your Lab Notebook (Manually)
To set up your lab notebook you'll first need to create a few pages, cut and paste some starting wiki code and put them in the right places. As soon as they are set up, you'll be a click away from creating new lab notebook entries.
The required pages are:
1. The Notebook page You should create the page as [[User:Your UserName/Notebook]]. This page does not require a template. On your new lab notebook page, add a link to a new page by adding the wiki code, [[/Test Project]]
2. The Project page This is the "Test Project" page you created a link to on your main notebook page. Cut and paste the short wiki code from one of the following boxes:
Standard <html><form class="formbody"><textarea class="form_format" rows="2" cols="10" onClick="this.select();">{{subst:Project_Base}}</textarea></form></html>
3. The Entry Base page Click on the "customize your entry pages" link to create the "entry base page". On this new page, cut and paste the short wiki code from one of the following boxes:
Standard <html><form class="formbody"><textarea class="form_format" rows="2" cols="10" onClick="this.select();">{{subst:Entry_Base}}</textarea></form></html>
By putting these pages in their proper places you will not only keep OWW tidy, but you'll also be able to take full advantage of the features we've built into the lab notebook.
By simply copying and pasting the wiki code from the boxes, you'll have your lab notebook working in no time. It's as simple as 1, 2, 3!
3/5/15 Bacteria 16S SequencePurpose: This lab used genetic sequences found in Transect Three to identify exactly what species of bacteria inhabit the area.
Materials & Methods: During the Microbiology Lab we performed a Polymerase Chain Reaction on bacteria from our Hay Infusion Culture. We selected one sample from a nutrient agar plate and one sample from a tetracycline plate to perform the PCR on. We transferred a single bacterial colony from each plate to a 100 microliters of distilled later in a sterile tube. We incubated the tubes for 10 minutes at 100 degrees Celsius and then centrifuged them for 5 minutes at 13,400 rpm. We added 20 microliters of primer to a PCR tube which contained a PCR bead, and then transferred 5 microliters of supernatant from our centrifuged samples to the PCR tube and placed it in the PCR machine. The PCR amplified the 16S gene, we received a sequence from this, which we entered into BLAST. BLAST identified which type of bacteria the sample came from using the full 16S rRNA sequence we were given.
Results: Our Samples were labelled 13A and 13D. 13A was identified as Chryseobacteria and 13D was identified as Variovorax. Sample 13A was dubbed MB65 and had 134 nucleotides. Sample 13D was dubbed MB66 and had 135 nucleotides. Their raw sequences are given below.
Sample 13A: NNNNNNNNNNNNNNNNNCNNNNNNTGCNGNNNNANGGNNGNCNGNNNNNNANCAATCCTGGCGGCGAGTGGCGAACGGGT GAGTAATACATCGGAACGTGCCCAATCGTGGGGGATAACGCAGCGAAAGCTGTGCTAATACCGCATACGATCTACGGATG AAAGCAGGGGATCGCAAGACCTTGCGCGAATGGAGCGGCCGATGGCAGATTAGGTAGTTGGTGAGGTAAAGGCTCACCAA GCCTTCGATCTGTAGCTGGTCTGAGAGGACGACCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAG CAGTGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACT GCTTTTGTACGGAACGAAACGGCCTTTTCTAATAAAGAGGGCTAATGACGGTACCGTAAGAATAAGCACCGGCTAACTAC GTGCCAGCAGCCGCGGTAATACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATGT AAGACAGTTGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGTGACTGCATAGCTAGAGTACGGTAGAGGGGGATGG AATTCCGCGTGTAGCANTGNAATGCGTAGATATGCGGAGGAACACCGATGGCGAANGCAATCCCCTGGACCTGTACTGAC GCTCATGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGTCAACTGGTTGTT GGGTCTTCACTGACTCANTAACGAAGCTNACNCGTGAAGTTGACCGCCTGGGGAGTACGGCCGCAANGTTGAAACTCNAA NGAATTGACNNGGACCCGCACAAGCNGTGNATGATGTGNTTTAATTCNATGCAACGCGAAAACCTTACCCACCTTTGACA TGTACNNNANTTNNNCCAGANATGGCTTANTGCTCGAAANAAAANCGTAACNCANGTGCTNCATGNCTNNCGTCNNCNTC NTGTCGTGANA
Sample 13D:NNNNNNNNNNNNNNNNNANANTGNANNCCNNAGCGGTAGCAGANGNTATCANGATGTCCGACAGCGGCTTGCNGATGAGG TACAAGTGTGGTTTATGCCTTTAGCCGGGGGAGGCACTTTCGTTGGGAAGATTACAACCCCATAATTATAATCGTGGCAT CTCTTGAAANGGACTGGTCCAGTGGAAAAAGAAGGGCCCGACCCTGATGANGCAGTTGGTACGGGGACGGTTCACCANGG CTGTGATGTTTGTGGGGCCTGANAGGGTGATCCCCCTGTGTGGTACGGAGACATTGACCCAACACCAATTGCAGGCGCCT CTGAGGAATATTGGACAATGGGTGAGAGCCTGATCNNNANTCNNCGNGAAGGATGACGGTGCTCCTGGTTGTATTCTTCT TTTGTATATTGATGGTGATTTCCTCGTGGGTGAAGCTGAATGAACTATACAAGCAGNAACCGGNGAGGCCCNTGCCTTCA GCCTCGGTNNTACNCAGGGTGTTGCCGTTTGAGAGATTTATTGNNTTNTCGAGGTTGGTTCNNGCNGANGGCNNACAATA TGCTGTANNNNTNACTNNNNGGTCAATCTGCATANGTTGGCGCGNGNCGCGACTNTTGGATATCTACCTTGCNTAAAANA NTCNNACANGGAANNCNTANATAATANCNNNNNCACCAATTGCGAANGCAGGTTACTATGTCTTAACTGACGCTGATGGA CGAAAGCGTGGGGAGCGAACAGGATTANATACCCTGGTANTCCACGCCNTNNNNNATGCTNACTCGTTTTTGGGNTCTTC NGATTCAGAGACTAAACNAAAGTGATAAGTTAGCCACCTGGGGAGTACGTTCNCAAGANTGAAACTCNAAGGAATTGACN GNNCCCGCACAANCGGNGGATTATGTGNNTTNATTCNATGATACGCNANGAANCCTTNNCCNANGCTTAANTGGGNANTN GATCGGTTTNNNANNNNACCTTNCCTTNNNCAATTTCAAGGTNCTGCATGGNTNGTCNNCNGCTNNNNCCNNNANTNNNA GNTAANTCCTGNNNNNNNGNNNCCCCNTGTCNCNNN
Conclusion: Some of our findings were contrary to information uncovered upon research of the actual bacteria identified. For example, Sample 13A came from a tetracycline plate and was identified by BLAST as Variovorax. Our observations said that the bacteria was not motile, rod shaped, gram positive, and most likely a strepto bacilli. However research proved that Variovorax is a rod shaped gram negative bacteria. Our method of determining if a bacteria was gram negative or positive was by observing the color of the bacteria on a wet mount in a compound microscope. Some of our wet mounts had both pink and purple on them, so we could have interpreted the results incorrectly. However, it was hard to find an in-depth explanation of the appearance of Variovorax. Our other sample, Sample 13D was identified as Chryseobacteria. We observed this sample as yellow, round, smooth, concentrated, flat, vibrating, and gram negative. Chryseobacteria are yellow, round and gram negative, which matches what we found when examining the bacteria with a compound microscope. Our two bacterial samples have similar characteristics. They are both bacilli and gram negative. Gram negative means that they did not retain the crystal violet dye used in the procedure because they have less peptidoglycan in their cell walls. Variovorax inhabits soil, as does Chryseobacteria. Both bacterias can survive extreme temperatures, which means that this snow day should be a piece of cake for them.
References
Han, J.-I., Choi, H.-K., & Lee, S.-W. (2011). Complete Genome Sequence of the Metabolically
Versatile Plant Growth-Promoting Endophyte Variovorax paradoxus S110. Journal of Bacteriology,
