IGEM:Cambridge/2008/Magnetic Bacteria: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
Line 86: Line 86:
==Biobrick Selection and Amplification 23 July 2008==
==Biobrick Selection and Amplification 23 July 2008==


New standardised vector to be used for mms6 and mamC genes, along with promoter and terminator.
New standardised vector to be used for mms6 and mamC genes, along with promoter, ribosome binding site and terminator.

Revision as of 09:01, 23 July 2008

Magnetic Bacteria

The idea is to generate magnetic organelles in E.coli that resembles magnetosomes of magnetotactic bacteria. This is a multistep process. First, the cell is grown in iron-rich media (see below) to allow iron uptake. Then, invaginations of the inner membrane is induced by expression of the b subunit of the F1F0 ATP synthase. Iron uptake into the membrane folds is mediated by the product of the Magnetospirillum gene MagA, which functions as a proton/iron antiporter. Finally, biomineralisation is achieved by small protein encoded by another gene found in the magnetosome island.

Iron uptake

To increase cytosolic iron content, strains can be grown in iron rich media (see below). For wild type E.coli, this results in a 1.5-2.5 fold increase in IC iron content (Abdul-Tehrani et al J Bacteriol 181.5.1415-1428). In addition, a series of mutant strain are considered: ferretin (ftn), bacterioferretin (bfr), fur, superoxide dismutase (sod). Fur and sod mutants seems particularly promising as each results in a 7 fold increase in IC iron content in the presence of high IC iron. Furthermore, the effects of double mutations are additive (Keyer, Proc. Natl. Acad. Sci. USA 93.13635-13640). For comparison, Magnetospirillum has a 10 fold higher iron content than E.coli.

Update: the fur mutant strain is probably most promising as it uncouples the negative feedback loop regulating iron import protein synthesis. Can be obtained from Dr Jim Imlay or the Yale stock centre.

Mms6

http://www.jbc.org/cgi/content/full/278/10/8745

Copied from the above paper...

"Oligonucleotide primers were designed using the N-terminal amino acid sequence. The codon usage pattern of previously reported proteins in strain AMB-1 was used (7-9). Gene walking was performed to obtain the entire gene encoding the Mms5 and Mms6 proteins. Primer S1 (CAGGCCCTTGCCGGTCCAGATGGT) and primer S2 (ATCATCCTGGGCGTTGTTGGCGCC) were used to amplify the mms6 region. Primer S3 (GTGCTGCTGGGCGTGGTCGGCGTG) and primer S4 (CACGCCGACCACGCCCAGCAGCAC) were designed for the mms5 region. To sequence the mms7-13 region, primer mms7-13F (GCCTAACCAAATCCAGATGAG) and primer mms7-13R (CCGTAAGGAAAGACAGACACG) were designed from the genome sequence data of M. magneticum AMB-1.2 The other primers for sequencing the region containing mam7, mam13, and mms6 were designed from the same data base. The preliminary sequence data of M. magnetotacticum MS-1 obtained from the DOE Joint Genome Institute3 was used for comparison. The amplified PCR fragment was cloned into the pGEM-T-easy vector (pGEM-T-easy vector system, Promega, Madison, WI) and sequenced using ABI PRISM 377 (PerkinElmer Life Sciences).

The computer software package LASERGENE (DNASTAR, Inc. Madison, WI) was used for DNA and protein sequence analyses. The sequence was further analyzed by performing homology searches using the programs FASTA and BLAST against the GenBankTM/EBI DNA Data Bank.

Expression and Purification of Recombinant Protein-- The recombinant plasmid pET15b-mms6, containing the sequence coding the mature Mms6 protein, was constructed by cloning PCR products into the expression vector pET15b. The primer set 5'-GGGGGACATATGGTCGGTGGAACCATCTGGACCGGTAAG-3' and 5'-GGGGGATCCAAATCAGGCCAGCGCGTCGCGCAGTTCGAC-3' was used for amplification of the mms6 gene from AMB-1 genomic DNA. E. coli BL21 cells were cultured in 200 ml of Luria broth at 37 °C under isopropyl-1-thio-beta -D-galactopyranoside induction. The recombinant protein was purified under denaturing conditions using a nickel-nitrilotriacetic acid column (QIAGEN). The eluted protein was diluted in the same volume of refolding buffer (50 mM Tris-HCl, 1 mM EDTA, 0.1 M L-arginine, 1 mM reduced glutathione, 10% (v/v) glycerol, and 0.8 mM oxidized glutathione (pH 8.0)). The purified protein was renatured by dialysis in 0.5 liter of buffer (0.01 M Tris-HCl, 10% glycerol, and 0.01 M EDTA (pH 8.0)) containing 4 and 2 M urea for 3 h each. Final dialysis was performed overnight in 1 liter without urea. The protein was further dialyzed for 3 h several times against 1 liter of fresh Tris-HCl (pH 8.0). All dialysis steps were performed at 4 °C. The His tag of the recombinant protein was digested with thrombin (QIAGEN) and then removed by filtration using a miniprep Microcon YM-3 membrane (Millipore Corp.)."

Magnetite Formation in vitro with mms6

http://www.cmpgroup.ameslab.gov/supermaglab/Papers/2007/AFM-2007.pdf

http://www.sciencedirect.com/science?_ob=MImg&_imagekey=B6TWB-4PHJGW6-2-1&_cdi=5558&_user=6094838&_orig=search&_coverDate=12%2F31%2F2007&_sk=999719964&view=c&wchp=dGLzVzz-zSkzk&md5=ba3dae3911d25454b4c6e7a92019ba26&ie=/sdarticle.pdf


Media composition (week 2)

Paper 1

http://iai.asm.org/cgi/reprint/56/9/2430.pdf

This paper is on the different expression of genes in E.coli in iron-rich and iron-deficient media and they were shifting the bacteria from high-iron to low-iron content in the expt. Their media prepared as follows:

Protocol: Cells of E. coli were routinely grown in Luria broth (LB) at 37°C with shaking LB was supplemented with appropriate antibiotics at the following concentrations: ampicillin, 50 ,ug/ml; and chloramphenicol, 30 jig/ml LB containing 10 g of tryptone, 5 g of yeast extract, and 10 g of sodium chloride per liter was used as the iron-rich medium Deferrated LB was prepared by treating LB with 10 g of chelex 100 (Bio-Rad Laboratories, Richmond, Calif.) per liter for 4 h The deferrated LB was decanted, and residual chelex 100 was removed by filtration. The deferrated LB was transferred to acid-washed Pyrex bottles and sterilized by autoclaving A single large batch of deferrated medium was prepared, stored at 4°C, and used throughout the study I think we can probably try to follow their protocol in preparing the deferrated LB medium then increase the iron content accordingly as we wish... Iron can be supplemented in the form of iron citrate...We can prepare a stock solution of iron citrate (1:100 iron to citrate ratio) following the protocols on the paper printed on Friday...

Paper 2

http://www.ncbi.nlm.nih.gov/pubmed/10049371

Iron citrate stock solution protocol: A stock solution of iron citrate (iron-to-citrate ratio, 1:100) was made by dissolving ferrous sulfate (final concentration, 4 mM) in sodium citrate (final concentration, 400 mM) pH is adjusted to 7 with NaOH Sodium citrate was prepared in an identical way, but the ferrous sulfate was omitted for the control i.e. iron free medium The only concern I have is whether we need to remove absolutely all iron and if the deferration method is removing all iron ions or just certain ion...?! Another iron-removing protocol is also mentioned in this second paper so we can pick one to use...or maybe ask Duncan first :-/

"The iron concentration of L broth was reduced by extraction with 8-hydroxyquinoline by the method of Pugsley and Reeves J Bacteriol. 1976;127:218–228."

Anaerobic growth protocol...if needed: Anaerobic fermentative growth was performed in 15-ml optically matched glass tubes filled to the top with L broth plus 0.5% glucose, sealed with Subaseal caps, and incubated at 37°C in a water bath without shaking Anaerobic respiratory conditions were identical, except that either 40 mM sodium fumarate or 40 mM sodium nitrate was added to the medium. Paper 3

http://www.jbmb.or.kr/jbmb/jbmb_files/%5B36-6%5D0311211203_p608.pdf

This paper is on the regulation of the iron-dependent expression of some genes in E.coli by comparing cultures in iron-supplemented and normal medium...

Here is the protocol they have indicated in the paper which I think is not as appropriate as the one above...??? The LB medium contained 10 g Bactotryptone,5 g yeast extract, and 10 g NaCl per l and was adjusted to pH 7.0 with ~1.5 g of K2HPO4 The M9CA medium consisted of minimal A salts (Maniatis et al., 1982), 0.2% casamino acids, 0.2% glucose, 3 mg pantothenate, and 5 mg of thiamine per litre. The strains were grown overnight at 37oC (with shaking in the air) in a LB medium containing the required antibiotics The overnight cultures were diluted 200-fold into a M9CA medium and grown to a density of A600 = 0.6 − 0.8 The nice thing is that this paper has mentioned the iron assay (flame test thingie) as well as the result for the iron concentration within E.coli in the iron-supplemented medium!

Iron assay: The iron content of the cell-free extracts was measured using a flame atomic absorption spectrophotometer (Varian Spectra AA 400, Minasco Australia Pty Ltd., Sunbury, Australia) with a deuterium background corrector The samples were diluted 1 : 5 with de-ionized water Seronorm 103 serum standard (Nycomed, Oslo, Norway) was used for the standardization of the element analysis and the mean (n = 7) concentration of iron deviated −3% from the certified value As a reference material, bovine liver standard 1577a (National Institute of Standards and Technology, Gaithersburg, USA) was used for validation of the analytical methods. The analytical value (n = 7) for iron deviated −1.3% from the certified value Result: "E. coli, when grown in an iron-enriched medium, contained about four fold more iron (6.1 ± 0.6 ng iron/mg protein) compared to the cells that were grown in a normal M9CA medium (1.5 ± 0.3 ng iron/mg protein)." So according to this paper they've got a 4 fold increase in iron concentration in E.coli...! Don't know if that'll be enough...

Biobrick Selection and Amplification 23 July 2008

New standardised vector to be used for mms6 and mamC genes, along with promoter, ribosome binding site and terminator.