IGEM:Cambridge/2008/Notebook/Voltage/Gene Design

KdpF-C Biobrick

Gene Selection

• Kdp is a well documented P-Type K+ ATPase found naturally in E.coli, used to actively pump ions into the cell.
• It consists of a 6-gene operon: F,A,B,C,D,E Where F-C are the functional membrane protein subunits, and D-E comprises a bacterial 2-component regulatory system.

• Literature shows that Kdp acts as a high-affinity transport system, and works most effectively at low external potassium concentrations, where a change in ion flux would be most likely to produce a measurable voltage difference.
• The D-E 2-component system consists of a membrane protein turgidity sensor and a transcription factor. It controls Kdp operon expression in vivo, by reducing gene expression when turgor is high.
• Since we wish to over-express Kdp, we decided not to include the regulatory system in our biobrick. (Osmotic buffering would be used instead.)

Amplification from E.coli MG1655

• This was performed via PCR amplification of the genome template using the following primers:

         -Forward: ATATGAATTCATATTCTAGATGAGTGCAGGCGTGATAACCGGCGTATT 
                       EcoRI      XbaI

         -Reverse: CTCTCTGCAGCTCTACTAGTTTATTCATCAAGTTTATCCAGCGCCAGAT

• Primer overhangs incorporated the biobrick prefix and suffix into the section, restriction sites shown in bold .
• The result of this PCR is shown below: