KdpF-C Biobrick

Gene Selection

Kdp is a well documented P-Type K+ ATPase found naturally in E.coli, used to actively pump ions into the cell.
It consists of a 6-gene operon: F,A,B,C,D,E Where F-C are the functional membrane protein subunits, and D-E comprises a bacterial 2-component regulatory system.

Literature shows that Kdp acts as a high-affinity transport system, and works most effectively at low external potassium concentrations, where a change in ion flux would be most likely to produce a measurable voltage difference.
The D-E 2-component system consists of a membrane protein turgidity sensor and a transcription factor. It controls Kdp operon expression in vivo, by reducing gene expression when turgor is high.
Since we wish to over-express Kdp, we decided not to include the regulatory system in our biobrick. (Osmotic buffering would be used instead.)

This was performed via PCR amplification of the genome template using the following primers:

         -Forward: ATATGAATTCATATTCTAGATGAGTGCAGGCGTGATAACCGGCGTATT 
                       EcoRI      XbaI

         -Reverse: CTCTCTGCAGCTCTACTAGTTTATTCATCAAGTTTATCCAGCGCCAGAT
                       PstI       SpeI

Primer overhangs incorporated the biobrick prefix and suffix into the section, restriction sites shown in bold .
The result of this PCR is shown below:

The vector used was low copy-number plasmid pSB4C5, with chloramphenicol resistance and a death gene as selection markers.
Kdp PCR product and pSB4C5 were both cut with EcoRI & SpeI, (vector backbone was dephosphorylated to prevent circularisation) then ligation into the vector can occur as shown.

. . . . . . . . . . . . . . . . . . . . . . . .
Note: pSB4C5_Kdp biobrick plasmid has no promoter/RBS and so Kdp is not expressed in transformants.

The promoter chosen for use with Kdp was OsmY (Part BBa_J45992).
It is a stationary phase promoter, and since we require high cell densities in our final "voltage measurement" medium, we want Kdp to only be expressed in stationary phase.
This will reduce the metabolic and osmotic stress on dividing cells in exponential phase.

Three different strength RBSs were investigated, B0030, B0031 and B0032.
B0030 is the strongest(15bp length), B0031 medium(14bp) and B0032 weakest(13bp).
Investigating three will help us determine the optimum levels of Kdp expression.

These parts were extracted using PCR from the Registry of Standard Biological Parts. However, the RBS biobricks are so small that we built their sequences into the reverse primers.