IGEM:Cambridge/2008/Turing Pattern Formation/Primers

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 106: Line 106:
====Bacillus RBS Primers====
====Bacillus RBS Primers====
We made primer sets for 2 ribosomal binding sites in Bacillus of differing binding strengths. We expect B._sub_RBSs to bind very strongly because it is the consensus sequence for RBS in B. subtilis.
We made primer sets for 2 ribosomal binding sites in Bacillus of differing binding strengths. We expect B._sub_RBSs to bind very strongly because it is the consensus sequence for RBS in B. subtilis.
 +
 +
 +
{| class="wikitable" border="1"
 +
|-
 +
! Primer name
 +
! Parent vector
 +
! init. length
 +
! init. Tm
 +
! init. GC%
 +
! final length
 +
! final Tm
 +
! final GC
 +
|-
 +
|RBS s forward
 +
|
 +
|
 +
|
 +
| 15.3%
 +
| 20
 +
| 55.0+3
 +
| 55.0%
 +
|-
 +
|colspan="8" align=center|<pre>CCGCTTCTAGAG AAAGGAGG</pre>
 +
|-
 +
|RBS w forward
 +
|
 +
|
 +
|
 +
|
 +
| 20
 +
| 63.4+3
 +
| 60.0%
 +
|-
 +
|colspan="8" align=center|<pre>CCGCTTCTAGAG AGAGGTGG</pre>
 +
|-
 +
|}
 +
 +
<pre>
<pre>

Revision as of 09:05, 15 September 2008

Contents

Promoter Primers

Temperatures were calculated using https://www.finnzymes.fi/tm_determination.html. The uppercase letters match the plasmid sequence, while the lowercase letters are 'bumper bases' for restriction cuts and the biobrick prefix and suffixes. Bumper bases, biobrick prefixes, and plasmid DNA are separated by spaces.

Primer name Parent vector init. length init. Tm init. GC% final length final Tm final GC
pXyl promoter forward pSG1154 (ECE153) 26 58.7+3 15.3% 50 80.0+3 34.0%
at gaattcgcggccgcttctagag TTCATGAAAAACTAAAAAAAATATTG
pXyl promoter reverse pSG1154 (ECE153) 26 bp 63.0+3 26.6 % 50 79.5+3 44.0%
gat ctgcagcggccgctactagta TATGTCATATTGTAAGTAAGTTGCAC
pSpac promoter forward pMUTIN-YFP (ECE151) 22 58.5+3 36.3% 46 82.6+3 45.6%
at gaattcgcggccgcttctagag AGAACAACCTCTGCTAAAATTC
pSpac promoter reverse pMUTIN-YFP (ECE151) 21 59.3+3 38.0% 45 80.4+3 46.6%
tat ctgcagcggccgctactagta AAGCTTAATTGTTATCCGCTC
pPac promoter forward pMUTIN-YFP (ECE151) 21 61.7+3 38.0% 45 84.5+3 46.6%
at gaattcgcggccgcttctagag AAACGAGGTCATCATTTCCTT
pPac promoter reverse pMUTIN-YFP (ECE151) 26 57.7+3 26.6% 50 82.1+3 46.0%
cgc ctgcagcggccgctactagta CAAATGTAGTCTTTGAAAGTATTACA
pUpp promoter forward pAD45-25 (ECE166) 22 58.8+3 27.2% 46 82.6+3 41.3%
at gaattcgcggccgcttctagag GATGAATAAATTTTGGCGATAT
pUpp promoter reverse pAD45-25 (ECE166) 25 60.9+3 36.0% 49 80.3+3 44.8%
tat ctgcagcggccgctactagta GAGGATCAAATACATACAGTTTTCC

Bacillus RBS Primers

We made primer sets for 2 ribosomal binding sites in Bacillus of differing binding strengths. We expect B._sub_RBSs to bind very strongly because it is the consensus sequence for RBS in B. subtilis.


Primer name Parent vector init. length init. Tm init. GC% final length final Tm final GC
RBS s forward 15.3% 20 55.0+3 55.0%
CCGCTTCTAGAG AAAGGAGG
RBS w forward 20 63.4+3 60.0%
CCGCTTCTAGAG AGAGGTGG


B. subtilis consensus RBS - http://www.ncbi.nlm.nih.gov/pubmed/10446248

B._sub_RBSs_F
*5' GAATTCGCGGCCGCTTCTAGAG AAAGGAGG TGTTA 3'

B._sub_RBSs_R
*5' CTGCAGCGGCCGCTACTAGTAACA CCTCCTTT CTCT 3'


RBS modified from ECE112 SpoVG RBS - http://www.bgsc.org/Catalogs/Catpart4.pdf

B._sub_RBSw_F
*5' GAATTCGCGGCCGCTTCTAGAG AGAGGTGG TGTTA 3'

B._sub_RBSw_R
*5' CTGCAGCGGCCGCTACTAGTAACA CCACCTCT CTCT 3'

Agr Primers

  • These primers are to extract each part of the Agr operon so that a Bacillus RBS can replace the E. coli RBS currently attached to the genes.
agr senders
Agr_B_F
*5' GTTTCTT C GAATTC GCGGCCGC  T  TCTAG ATGaactattttgacaacaa 3'
 
Agr_B_R 
*5' TT C CTGCAG CGGCCGC  T  ACTAGT A TTATTA  tttcagatcctctttgatg 3'

Agr_D_F
*5' CTT C GAATTC GCGGCCGC  T  TCTAG atgaatactctgttcaatctgtttt 3'

Agr_D_R
*5' TT C CTGCAG CGGCCGC  T  ACTAGT A TTATTA ttcatgcagctgggtcagct 3'
agr receivers
Agr_C_F
*5' GTTTCTT C GAATTC GCGGCCGC  T  TCTAG atgattctgatgttcaccat 3' 

Agr_C_R
*5' TT C CTGCAG CGGCCGC  T  ACTAGT A TTATTA gttattgatgatttcgactt 3' 

Agr_A_F
*5' GTTTCTT C GAATTC GCGGCCGC  T  TCTAG  atggaaatcgcactggcta 3'

Agr_A_R
*5' TT C CTGCAG CGGCCGC  T  ACTAGT A TTATTA  gattttcttgacattgcgta 3'
Personal tools