IGEM:Cambridge/2008/Turing Pattern Formation/Primers: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Yee Yen Tang (talk | contribs) No edit summary |
|||
| Line 111: | Line 111: | ||
|- | |- | ||
! Primer name | ! Primer name | ||
! final length | ! final length | ||
! final Tm | ! final Tm | ||
| Line 120: | Line 116: | ||
|- | |- | ||
|RBS s forward | |RBS s forward | ||
| 20 | | 20 | ||
| | | 62.3 | ||
| 55.0% | | 55.0% | ||
|- | |- | ||
| Line 131: | Line 123: | ||
|- | |- | ||
|RBS w forward | |RBS w forward | ||
| 20 | | 20 | ||
| 63.4 | | 63.4 | ||
| 60.0% | | 60.0% | ||
|- | |- | ||
Revision as of 06:44, 15 September 2008
Promoter Primers
Temperatures were calculated using https://www.finnzymes.fi/tm_determination.html. The uppercase letters match the plasmid sequence, while the lowercase letters are 'bumper bases' for restriction cuts and the biobrick prefix and suffixes. Bumper bases, biobrick prefixes, and plasmid DNA are separated by spaces.
| Primer name | Parent vector | init. length | init. Tm | init. GC% | final length | final Tm | final GC |
|---|---|---|---|---|---|---|---|
| pXyl promoter forward | pSG1154 (ECE153) | 26 | 58.7+3 | 15.3% | 50 | 80.0+3 | 34.0% |
at gaattcgcggccgcttctagag TTCATGAAAAACTAAAAAAAATATTG | |||||||
| pXyl promoter reverse | pSG1154 (ECE153) | 26 bp | 63.0+3 | 26.6 % | 50 | 79.5+3 | 44.0% |
gat ctgcagcggccgctactagta TATGTCATATTGTAAGTAAGTTGCAC | |||||||
| pSpac promoter forward | pMUTIN-YFP (ECE151) | 22 | 58.5+3 | 36.3% | 46 | 82.6+3 | 45.6% |
at gaattcgcggccgcttctagag AGAACAACCTCTGCTAAAATTC | |||||||
| pSpac promoter reverse | pMUTIN-YFP (ECE151) | 21 | 59.3+3 | 38.0% | 45 | 80.4+3 | 46.6% |
tat ctgcagcggccgctactagta AAGCTTAATTGTTATCCGCTC | |||||||
| pPac promoter forward | pMUTIN-YFP (ECE151) | 21 | 61.7+3 | 38.0% | 45 | 84.5+3 | 46.6% |
at gaattcgcggccgcttctagag AAACGAGGTCATCATTTCCTT | |||||||
| pPac promoter reverse | pMUTIN-YFP (ECE151) | 26 | 57.7+3 | 26.6% | 50 | 82.1+3 | 46.0% |
cgc ctgcagcggccgctactagta CAAATGTAGTCTTTGAAAGTATTACA | |||||||
| pUpp promoter forward | pAD45-25 (ECE166) | 22 | 58.8+3 | 27.2% | 46 | 82.6+3 | 41.3% |
at gaattcgcggccgcttctagag GATGAATAAATTTTGGCGATAT | |||||||
| pUpp promoter reverse | pAD45-25 (ECE166) | 25 | 60.9+3 | 36.0% | 49 | 80.3+3 | 44.8% |
tat ctgcagcggccgctactagta GAGGATCAAATACATACAGTTTTCC | |||||||
Bacillus RBS Primers
We made primer sets for 2 ribosomal binding sites in Bacillus of differing binding strengths. We expect B._sub_RBSs to bind very strongly because it is the consensus sequence for RBS in B. subtilis.
| Primer name | final length | final Tm | final GC | ||||
|---|---|---|---|---|---|---|---|
| RBS s forward | 20 | 62.3 | 55.0% | ||||
CCGCTTCTAGAG AAAGGAGG | |||||||
| RBS w forward | 20 | 63.4 | 60.0% | ||||
CCGCTTCTAGAG AGAGGTGG | |||||||
B. subtilis consensus RBS - http://www.ncbi.nlm.nih.gov/pubmed/10446248 B._sub_RBSs_F *5' GAATTCGCGGCCGCTTCTAGAG AAAGGAGG TGTTA 3' B._sub_RBSs_R *5' CTGCAGCGGCCGCTACTAGTAACA CCTCCTTT CTCT 3'
RBS modified from ECE112 SpoVG RBS - http://www.bgsc.org/Catalogs/Catpart4.pdf B._sub_RBSw_F *5' GAATTCGCGGCCGCTTCTAGAG AGAGGTGG TGTTA 3' B._sub_RBSw_R *5' CTGCAGCGGCCGCTACTAGTAACA CCACCTCT CTCT 3'
Agr Primers
- These primers are to extract each part of the Agr operon so that a Bacillus RBS can replace the E. coli RBS currently attached to the genes.
agr senders
Agr_B_F *5' GTTTCTT C GAATTC GCGGCCGC T TCTAG ATGaactattttgacaacaa 3' Agr_B_R *5' TT C CTGCAG CGGCCGC T ACTAGT A TTATTA tttcagatcctctttgatg 3' Agr_D_F *5' CTT C GAATTC GCGGCCGC T TCTAG atgaatactctgttcaatctgtttt 3' Agr_D_R *5' TT C CTGCAG CGGCCGC T ACTAGT A TTATTA ttcatgcagctgggtcagct 3'
agr receivers
Agr_C_F *5' GTTTCTT C GAATTC GCGGCCGC T TCTAG atgattctgatgttcaccat 3' Agr_C_R *5' TT C CTGCAG CGGCCGC T ACTAGT A TTATTA gttattgatgatttcgactt 3' Agr_A_F *5' GTTTCTT C GAATTC GCGGCCGC T TCTAG atggaaatcgcactggcta 3' Agr_A_R *5' TT C CTGCAG CGGCCGC T ACTAGT A TTATTA gattttcttgacattgcgta 3'
